
                                  listor 
                                      
   
   
Function

   Writes a list file of the logical OR of two sets of sequences
   
Description

   listor reads in two sets of sequences and writes out a list file (file
   of file names) that result from the logical union of these two sets of
   sequences. It is a simple way of manipulating and editing lists or
   sets of sequences to produce a list file.
   
   When comparing sequences to see if they are the same between two sets
   of sequences, no use is made of the ID name or accession number of the
   sequences. Only the sequences themselves are compared. The comparison
   of the sequences is case-independent.
   
   The logical union is an OR operation by default. Other available
   operations are: AND, XOR and NOT.
   
   The (default) logical OR of the two sets of sequences is simply the
   result of merging the two sets of sequences, (without listing any
   shared sequences twice).
   
   A logical AND simply lists those sequences that occur in both sets of
   sequences.
   
   A logical XOR lists those sequences that ONLY occur in the first set
   or only occur in the second set - sequences occuring in both sets are
   ignored (the opposite of an AND).
   
   A logical NOT lists all those sequences in the first set except for
   those that also occur in the second set.
   
Usage

   An example of the four types of logical operation performed with the
   two sets of sequences comprising these sequences follows. The two sets
   of sequences are in the files named file1 and file2. There are 2
   sequences which are duplicated between these two files ('two' and
   'three') and the sequences 'one' and 'four' are unique to the files
   'file1' and 'file2' respectively.
   
   Here is a sample session with listor
   
   Write the logical OR of two lists:
   

% listor ../../data/file1 ../../data/file2 
Writes a list file of the logical OR of two sets of sequences
Output file [file1.list]: 
   
   Go to the input files for this example
   Go to the output files for this example
   
   Example 2
   
   Write the logical AND of two lists:
   

% listor ../../data/file1 ../../data/file2 -operator and 
Writes a list file of the logical OR of two sets of sequences
Output file [file1.list]: 
   
   Go to the output files for this example
   
   Example 3
   
   Write the logical XOR of two lists:
   

% listor ../../data/file1 ../../data/file2 -operator xor 
Writes a list file of the logical OR of two sets of sequences
Output file [file1.list]: 
   
   Go to the output files for this example
   
   Example 4
   
   Write the logical NOT of two lists:
   

% listor ../../data/file1 ../../data/file2 -operator not 
Writes a list file of the logical OR of two sets of sequences
Output file [file1.list]: 
   
   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers:
  [-firstset]          seqset     Sequence set USA
  [-secondset]         seqset     Sequence set USA
  [-outfile]           outfile    The list of sequence names will be written
                                  to this list file

   Additional (Optional) qualifiers:
   -operator           menu       The following logical operators combine the
                                  sequences in the following ways:
                                  OR - gives all that occur in one set or the
                                  other
                                  AND - gives only those which occur in both
                                  sets
                                  XOR - gives those which only occur in one
                                  set or the other, but not in both
                                  NOT - gives those which occur in the first
                                  set except for those that also occur in the
                                  second

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-firstset" associated qualifiers
   -sbegin1             integer    Start of each sequence to be used
   -send1               integer    End of each sequence to be used
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-secondset" associated qualifiers
   -sbegin2             integer    Start of each sequence to be used
   -send2               integer    End of each sequence to be used
   -sreverse2           boolean    Reverse (if DNA)
   -sask2               boolean    Ask for begin/end/reverse
   -snucleotide2        boolean    Sequence is nucleotide
   -sprotein2           boolean    Sequence is protein
   -slower2             boolean    Make lower case
   -supper2             boolean    Make upper case
   -sformat2            string     Input sequence format
   -sdbname2            string     Database name
   -sid2                string     Entryname
   -ufo2                string     UFO features
   -fformat2            string     Features format
   -fopenfile2          string     Features file name

   "-outfile" associated qualifiers
   -odirectory3         string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-firstset]
   (Parameter 1) Sequence set USA Readable set of sequences Required
   [-secondset]
   (Parameter 2) Sequence set USA Readable set of sequences Required
   [-outfile]
   (Parameter 3) The list of sequence names will be written to this list
   file Output file <sequence>.listor
   Additional (Optional) qualifiers Allowed values Default
   -operator The following logical operators combine the sequences in the
   following ways: OR - gives all that occur in one set or the other AND
   - gives only those which occur in both sets XOR - gives those which
   only occur in one set or the other, but not in both NOT - gives those
   which occur in the first set except for those that also occur in the
   second
   O (OR - merger of both sets)
   A (AND - only those in both sets)
   X (XOR - only those not in both sets)
   N (NOT - those of the first set that are not in the second)
   OR
   Advanced (Unprompted) qualifiers Allowed values Default
   (none)
   
Input file format

   The input sets of sequences can be of any valid USAs. The program was
   written to perform logical operations on list files, but in practice,
   wildcarded database entries and file names are also perfectly legal
   specifications of the input sequences.
   
  Input files for usage example
  
  File: ../../data/file1
  
>one
tagctagcg
>two
tagctagcggctacgt
>three
tagctattttatgctacgtcagtgac
   
  File: ../../data/file2
  
>two
tagctagcggctacgt
>three
tagctattttatgctacgtcagtgac
>four
gcgcggcgcgcgtgcgtcgttgctggggccc
   
Output file format

   The ouput is simply a list of the USAs (format and sequence
   specification) resulting from the required logical union of the two
   sets of input sequence.
   
   The order that the USAs are written out is not necessarily the same as
   the order of either of the input sets of sequences.
   
   The results of the four types of logical union follows. Note that the
   duplicated sequences in these two files have been given the same name.
   This is not necessary for the operation of listor as it compares the
   sequences themselves, not the ID names of the sequences.
   
  Output files for usage example
  
  File: file1.list
  
fasta::../../data/file1:one
fasta::../../data/file1:two
fasta::../../data/file1:three
fasta::../../data/file2:four
   
  Output files for usage example 2
  
  File: file1.list
  
fasta::../../data/file1:two
fasta::../../data/file1:three
   
  Output files for usage example 3
  
  File: file1.list
  
fasta::../../data/file1:one
fasta::../../data/file2:four
   
  Output files for usage example 4
  
  File: file1.list
  
   fasta::../../data/file1:one

Data files

   None.
   
Notes

   The program stores all of the input sequences in memory while it is
   working out the logical unions of the two sets of sequences. This
   means that it is restricted by the available memory. Doing logical
   unions involving all of the sequences in large databases, such as
   EMBL, is probably impractical unless you are lucky enough to have
   extraordinary amounts of memory on your machine.
   
References

   None.
   
Warnings

   If you try to do a logical union with all of the sequences in EMBL and
   another sequence set, this program will attempt to read all of the
   EMBL sequences into memory at once. This will probably not succeed.
   
Diagnostic Error Messages

   None.
   
Exit status

   It always exits with status 0.
   
Known bugs

   None.
   
See also

   Program name                          Description
   biosed       Replace or delete sequence sections
   cutseq       Removes a specified section from a sequence
   degapseq     Removes gap characters from sequences
   descseq      Alter the name or description of a sequence
   entret       Reads and writes (returns) flatfile entries
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Excludes a set of sequences and writes out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping the first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   union        Reads sequence fragments and builds one sequence
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file
   
Author(s)

   Gary Williams (gwilliam  rfcgr.mrc.ac.uk)
   MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
   Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
   
History

   Written (1 Aug 2001) - Gary Williams
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
