
                                  descseq 
                                      
   
   
Function

   Alter the name or description of a sequence
   
Description

   Most sequence formats allow, at the very minimum, a name for the
   sequence and some comments to be stored in the sequence file.
   
   Rather than using an editor to alter the name or the comments, descseq
   allows you to simply change them and write out a new file with the
   changes in and the sequence left unaltered.
   
   The default action is to replace the existing name or description with
   your new one, but by using the qualifier '-append' what you enter is
   appended to the existing name or description.
   
   Note that if you append to a description, no space is inserted by
   default bewteen the existing description and your appended text. You
   have to put in a space yourself if you require one.
   
Usage

   Here is a sample session with descseq
   
   Set the name of a sequence to "myclone23"
   
   
% descseq -seq ../../data/dna.text -out clone23.seq -name "myclone23" 
Alter the name or description of a sequence.

   Go to the input files for this example
   Go to the output files for this example
   
   Example 2
   
   Set the description of a sequence to "This is my clone number 244"
   

% descseq -seq ../../data/dna.text -out xy24.seq -desc "This is my clone number
 244" 
Alter the name or description of a sequence.
   
   Go to the output files for this example
   
   Example 3
   
   Append some text to the description of a sequence
   
   
% descseq -seq ../../data/dna.text -out est4.seq -desc " (submitted)" -append 
Alter the name or description of a sequence.

   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Sequence USA
  [-outseq]            seqout     Output sequence USA

   Additional (Optional) qualifiers:
   -name               string     Name of the sequence
   -description        string     Description of the sequence

   Advanced (Unprompted) qualifiers:
   -append             boolean    This allows you to append the name or
                                  description you have given on to the end of
                                  the existing name or description of the
                                  sequence.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    Start of the sequence to be used
   -send1               integer    End of the sequence to be used
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outseq" associated qualifiers
   -osformat2           string     Output seq format
   -osextension2        string     File name extension
   -osname2             string     Base file name
   -osdirectory2        string     Output directory
   -osdbname2           string     Database name to add
   -ossingle2           boolean    Separate file for each entry
   -oufo2               string     UFO features
   -offormat2           string     Features format
   -ofname2             string     Features file name
   -ofdirectory2        string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence USA Readable sequence Required
   [-outseq]
   (Parameter 2) Output sequence USA Writeable sequence <sequence>.format
   Additional (Optional) qualifiers Allowed values Default
   -name Name of the sequence Any string is accepted An empty string is
   accepted
   -description Description of the sequence Any string is accepted An
   empty string is accepted
   Advanced (Unprompted) qualifiers Allowed values Default
   -append This allows you to append the name or description you have
   given on to the end of the existing name or description of the
   sequence. Boolean value Yes/No No
   
Input file format

   descseq reads a normal sequence USA.
   
  Input files for usage example
  
  File: ../../data/dna.text
  
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
   
Output file format

   descseq writes the sequence file with a changed name or description.
   
  Output files for usage example
  
  File: clone23.seq
  
>myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
   
  Output files for usage example 2
  
  File: xy24.seq
  
>EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
   
  Output files for usage example 3
  
  File: est4.seq
  
>EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
   
Data files

   None.
   
Notes

   None.
   
References

   None.
   
Warnings

   None.
   
Diagnostic Error Messages

   None.
   
Exit status

   It always exits with status 0.
   
Known bugs

   None noted.
   
See also

   Program name                          Description
   biosed       Replace or delete sequence sections
   cutseq       Removes a specified section from a sequence
   degapseq     Removes gap characters from sequences
   entret       Reads and writes (returns) flatfile entries
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Writes a list file of the logical OR of two sets of sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Excludes a set of sequences and writes out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping the first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   union        Reads sequence fragments and builds one sequence
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file
   
Author(s)

   Gary Williams (gwilliam  rfcgr.mrc.ac.uk)
   MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
   Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
   
History

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
