|
|
tfextract |
An old public domain version is available at: ftp://ftp.ebi.ac.uk/pub/databases/transfac/transfac32.tar.Z
TRANSFAC started in 1988 with a printed compilation (Nucleic Acids Res. 16: 1879-1902, 1988) and was transferred into computer-readable format in 1990 (BioTechForum - Advances in Molecular Genetics (J. Collins, A.J. Driesel, eds.) 4:95-108, 1991). The basic structures of Table 1 and 2 of the compilation were taken as the core of the emergent database. The aim of the early compilation as well as of the TRANSFAC database is:
The program tfextract extracts data from the TRANSFAC database file site.dat. This file contains information on individual (putatively) regulatory protein binding sites. About half of these refer to sites within eukaryotic genes. Just under half of them resulted from mutagenesis studies, in vitro selection procedures starting from random oligonucleotide mixtures or from specific theoretical considerations. And finally, there are about 5% with consensus binding sequences given in the IUPAC code, many of them being taken from the compilation of Faisst and Meyer (Nucleic Acids Res. 20:3-26, 1992). A number of consensi have been generated by the TRANSFAC team, generally derived from the profiles stored in the MATRIX table.
The data is split up by taxonomic groups:
and placed in individual files:
These files are stored in the EMBOSS data directory, see Data Files below.
% tfextract Extract data from TRANSFAC Full pathname of transfac SITE.DAT: ../../data/site.dat |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-infile] infile Full pathname of transfac SITE.DAT
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers: (none)
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-infile] (Parameter 1) |
Full pathname of transfac SITE.DAT | Input file | Required |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
ftp://ftp.ebi.ac.uk/pub/databases/transfac/
AC R00077 XX ID HS$ALBU_01 XX DT 20.06.90 (created); ewi. DT 24.08.95 (updated); hiwi. XX TY D XX DE albumin; Gene: G000188. XX SQ tGGTTAGtaattactaa. XX SF -363 ST -338 XX BF T00368; HNF-1A;Quality: 1; Species: human, Homo sapiens. BF T00369; HNF-1;Quality: 1; Species: rat, Rattus norvegicus. BF T01950; HNF-1B;Quality: 1; Species: human, Homo sapiens. BF T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; OC tetrapoda; mammalia; eutheria; primates XX SO 0103; Hep3B SO 0289; rl XX MM gel retardation MM direct gel shift MM DNase I footprinting MM gel shift competition MM affinity chromatography MM methylation interference XX DR EMBL: M13075; HSALBEX1(695:711). XX RN [1] RA Frain M., Swart G., Monaci P., Nicosia A., Staempfli RA S., Frank R., Cortese R. RT The liver-specific transcription factor LF-B1 contains RT a highly diverged homeobox DNA binding domain RL Cell 59:145-157 (1989). RN [2] RA Frain M., Hardon E., Ciliberto G., Sala-Trepat J. M. RT Binding of a liver-specific factor to the human albumin RT gene promoter and enhancer RL Mol. Cell. Biol. 10:991-999 (1990). XX // [Part of this file has been deleted for brevity] DR EMBL: U11854; MM11854(1931:1941). XX RN [1] RA Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B. RA S., Sen R., Sheffery M., Ravetch J. V. RT PU.1 and an HLH family member contribute to the myeloid-specific RT transcription of the FcgammaRIIIA promoter RL EMBO J. 13:3852-3860 (1994). XX // AC R04413 XX ID MOUSE$FCGR3A_02 XX DT 14.05.97 (created); ewi. DT 14.05.97 (updated); ewi. XX TY D XX DE FcgammaRIIIA (low-affinity Fc receptor IIIA for IgG); Gene: G001014. XX SQ TTCCTC. XX EL MRR XX SF -48 ST -43 XX BF T00702; PU.1;Quality: 3; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; murinae XX SO 0495; A20 SO 0848; RAW264.7 XX MM direct gel shift MM methylation interference MM supershift (antibody binding) XX DR EMBL: U11854; MM11854(1971:1976). XX RN [1] RA Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B. RA S., Sen R., Sheffery M., Ravetch J. V. RT PU.1 and an HLH family member contribute to the myeloid-specific RT transcription of the FcgammaRIIIA promoter RL EMBO J. 13:3852-3860 (1994). XX // |
Y$ADH1_02 ACAATATGGACTTCCTCTTTTCTGG R04140 T00322; GCR1;Quality: 2; Species: yeast, Saccharomyces cerevisiae. |
|
|
|
|
|
|
HS$ALBU_01 tGGTTAGtaattactaa R00077 T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens. HS$ALBU_02 TTGGCA R00078 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus. HS$ALBU_03 TGGCA R00079 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus. HS$ALBU_04 TTAATAAT R00080 T00015; AFP1;Quality: 6; Species: human, Homo sapiens. HS$ALBU_05 TCTAGTTAATAATCTACAAT R00081 T00369; HNF-1;Quality: 4; Species: rat, Rattus norvegicus. MOUSE$FCGR3A_01 GTCTGCTGACC R04412 T00874; USF;Quality: 2; Species: human, Homo sapiens. MOUSE$FCGR3A_02 TTCCTC R04413 T00702; PU.1;Quality: 3; Species: mouse, Mus musculus. |
The output from tfextract is a set of files in the emboss/data directory containing reformatted sites from the transfac database.
These files are used by the tfscan program to search for TRANSFAC sites in sequences.
EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".
The directories are searched in the following order:
| Program name | Description |
|---|---|
| aaindexextract | Extract data from AAINDEX |
| cutgextract | Extract data from CUTG |
| printsextract | Extract data from PRINTS |
| prosextract | Builds the PROSITE motif database for patmatmotifs to search |
| rebaseextract | Extract data from REBASE |