|
|
seqretsplit |
Its main use is therefore to split a file containing multiple sequences into many files, each containing one sequence.
The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
Why would you want to split a multiple sequence file into many individual files?
EMBOSS programs can read in many sequences from one file where this is sensible. Sometimes EMBOSS programs can only read in one sequence at a time because that is the sensible way to do things, but your sequence is one sequence of many in a file. You can specify that sequence using the USA filename:sequenceID, but you may still feel more comfortable splitting your sequences up into many files first.
Many non-EMBOSS programs will also have restrictions on whether they can read in multiple sequence files or not.
% seqretsplit tembl:hsfa* Reads and writes (returns) sequences in individual files Output sequence [hsfau.fasta]: |
Go to the input files for this example
Go to the output files for this example
The specification of the output file is not used in this case.
At some point this ought to change and you will not be prompted for the output file at all.
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence database USA
[-outseq] seqoutall Output sequence(s) USA
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-firstonly boolean Read one sequence and stop
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -firstonly | Read one sequence and stop | Boolean value Yes/No | No |
>HSFAU X65923.1 H.sapiens fau mRNA ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttcagtcaaaaaaaaaa |
>HSFAU1 X65921.1 H.sapiens fau 1 gene ctaccattttccctctcgattctatatgtacactcgggacaagttctcctgatcgaaaac ggcaaaactaaggccccaagtaggaatgccttagttttcggggttaacaatgattaacac tgagcctcacacccacgcgatgccctcagctcctcgctcagcgctctcaccaacagccgt agcccgcagccccgctggacaccggttctccatccccgcagcgtagcccggaacatggta gctgccatctttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgccccg tcctgcgcgagctgctgcccaggcaggttcgccggtgcgagcgtaaaggggcggagctag gactgccttgggcggtacaaatagcagggaaccgcgcggtcgctcagcagtgacgtgaca cgcagcccacggtctgtactgacgcgccctcgcttcttcctctttctcgactccatcttc gcggtagctgggaccgccgttcaggtaagaatggggccttggctggatccgaagggcttg tagcaggttggctgcggggtcagaaggcgcggggggaaccgaagaacggggcctgctccg tggccctgctccagtccctatccgaactccttgggaggcactggccttccgcacgtgagc cgccgcgaccaccatcccgtcgcgatcgtttctggaccgctttccactcccaaatctcct ttatcccagagcatttcttggcttctcttacaagccgtcttttctttactcagtcgccaa tatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaac ggtcgcccagatcaaggtaaggctgcttggtgcgccctgggttccattttcttgtgctct tcactctcgcggcccgagggaacgcttacgagccttatctttccctgtaggctcatgtag cctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctgg aggatgaggccactctgggccagtgcggggtggaggccctgactaccctggaagtagcag gccgcatgcttggaggtgagtgagagaggaatgttctttgaagtaccggtaagcgtctag tgagtgtggggtgcatagtcctgacagctgagtgtcacacctatggtaatagagtacttc tcactgtcttcagttcagagtgattcttcctgtttacatccctcatgttgaacacagacg tccatgggagactgagccagagtgtagttgtatttcagtcacatcacgagatcctagtct ggttatcagcttccacactaaaaattaggtcagaccaggccccaaagtgctctataaatt agaagctggaagatcctgaaatgaaacttaagatttcaaggtcaaatatctgcaactttg ttctcattacctattgggcgcagcttctctttaaaggcttgaattgagaaaagaggggtt ctgctgggtggcaccttcttgctcttacctgctggtgccttcctttcccactacaggtaa agtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaaggtgagtga gagtattagtggtcatggtgttaggactttttttcctttcacagctaaaccaagtccctg ggctcttactcggtttgccttctccctccctggagatgagcctgagggaagggatgctag gtgtggaagacaggaaccagggcctgattaaccttcccttctccaggtggccaaacagga gaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgt caacgttgtgcccacctttggcaagaagaagggccccaatgccaactcttaagtcttttg taattctggctttctctaataaaaaagccacttagttcagtcatcgcattgtttcatctt tacttgcaaggcctcagggagaggtgtgcttctcgg |
One file for each input sequence is written out.
The names of the files it creates are derived from the ID name of the sequence, followed by an extension denoting the format of the sequence. You have no control over the names of the files it writes out.
For example, if the files embl:hsfa11* are read in and the output is specified as wibble.seq, then the following files are expected to be created:
hsfa110.fasta hsfa111.fasta hsfa112.fasta hsfa113.fasta hsfa114.fasta
(No file wibble.seq is created.)
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| skipseq | Reads and writes (returns) sequences, skipping the first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |