|
|
degapseq |
In fact, if does more than just this as it removes ANY non-alphabetic character from the input sequence, so as well as removing the gap-characters, it will remove such things as the '*' in protein sequences that indicates the position of a 'translated' STOP codon.
There are many different formats for storing sequences in files. Some sequence formats allow you to store aligned sequences, including the information on where gaps have been introduced to make the sequence align properly. This is indicated by using a special character to indicate that there is a gap at that position. Different sequence formats use different characters to indicate gaps. Some formats may use more than one type of character to indicate different types of gaps (e.g. gaps at the ends of the sequences, internal gaps, gaps introduced by a program or by a person editing the alignment, etc.) Some typicate characters used to indicate where gaps are may be: '.', '-' and '~'.
When EMBOSS programs read in a sequence that has gap-characters in, all gap characters are internally changed to '-' characters. i.e. EMBOSS only has one type of gap character. Thus any distinguishing characters for different gap types are reduced to a '-'. There is only one type of gap in EMBOSS.
degapseq removes any non-alphabetic character in the sequence, in effect this means that gaps and '*' characters are removed. The sequence is then written out.
% degapseq ../../data/dnagap.fasta nogaps.seq Removes gap characters from sequences |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence database USA
[-outseq] seqoutall Output sequence(s) USA
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
The input sequence can be nucleic or protein.
The input sequence can be gapped or ungapped.
>FASTA F10002 FASTA FORMAT DNA SEQUENCE ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGT |
>FASTA F10002 FASTA FORMAT DNA SEQUENCE ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGT |
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| cutseq | Removes a specified section from a sequence |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping the first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |