
                                vectorstrip 
                                      
   
   
                              Program vectorstrip
                                       
Function

   Strips out DNA between a pair of vector sequences
   
Description

   vectorstrip is intended to be useful for stripping vector sequence
   from the ends of sequences of interest. For example, if a fragment has
   been cloned into a vector and then sequenced, the sequence may contain
   vector data eg from the cloning polylinker at the 5' and 3' ends of
   the sequence. vectorstrip will remove these contaminating regions and
   output trimmed sequence ready for input into another application.
   
   vectorstrip is suitable for use with low quality sequence data as it
   can allow for mismatches between the sequence and the vector patterns
   provided. You can specify the maximum level of mismatch expected.
   
   Vector data can either be provided in a file or interactively. If
   presented in a file, vectorstrip will search all input sequences with
   all vectors listed in that file. The intention is that the user can
   maintain a single file for use with vectorstrip, containing all the
   linker sequences commonly used in the laboratory.
   
   The two patterns for each vector are searched separately against the
   sequence. Once the search is completed, each of the hits of the 5'
   sequence is paired with each of the hits of the 3' sequence and the
   resulting subsequences are output. For example, if the 5' sequence
   matches the sequence from (a) position 30-60, and(b)position 70-100,
   and the 3' sequence matches from 150-175, then two subsequences will
   be output: from 61-149, and from 101-149. The lower the quality of the
   sequence, the more likely multiple hits become if nonzero mismatches
   are accepted.
   
   Default behaviour is to report only the best matches between the
   vector patterns and the sequence. This means that if you specify a
   maximum mismatch level of 10%, but the vector patterns match the
   sequence with zero mismatches, the search will stop and the program
   will output only these "best" matches. If there are no perfect
   matches, the program will try searching again allowing 1 mismatch,
   then 2, and so on until either the patterns match the sequence or the
   maximum specified mismatch level is exceeded. You can tell vectorstrip
   to show all possible matches up to your specified maximum level, as
   illustrated in the examples below.
   
Usage

   Here is a sample session with vectorstrip
   

% vectorstrip @../../data/vecseqs.list 
Strips out DNA between a pair of vector sequences
Are your vector sequences in a file? [Y]: 
Name of vectorfile: ../../data/vectors
Max allowed % mismatch [10]: 
Show only the best hits (minimise mismatches)? [Y]: 
Output file [pbluescript.vectorstrip]: vector.strip
Output sequence [pbluescript.fasta]: vector.fasta
   
   Go to the input files for this example
   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Sequence database USA
  [-[no]vectorfile]    boolean    Are your vector sequences in a file?
*  -vectorsfile        infile     Name of vectorfile
   -mismatch           integer    Max allowed % mismatch
   -[no]besthits       boolean    Show only the best hits (minimise
                                  mismatches)?
*  -linkera            string     5' sequence
*  -linkerb            string     3' sequence
  [-outfile]           outfile    Output file name
  [-outseq]            seqoutall  Output sequence(s) USA

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outfile" associated qualifiers
   -odirectory3         string     Output directory

   "-outseq" associated qualifiers
   -osformat4           string     Output seq format
   -osextension4        string     File name extension
   -osname4             string     Base file name
   -osdirectory4        string     Output directory
   -osdbname4           string     Database name to add
   -ossingle4           boolean    Separate file for each entry
   -oufo4               string     UFO features
   -offormat4           string     Features format
   -ofname4             string     Features file name
   -ofdirectory4        string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence database USA Readable sequence(s) Required
   [-[no]vectorfile]
   (Parameter 2) Are your vector sequences in a file? Boolean value
   Yes/No Yes
   -vectorsfile Name of vectorfile Input file Required
   -mismatch Max allowed % mismatch Any integer value 10
   -[no]besthits Show only the best hits (minimise mismatches)? Boolean
   value Yes/No Yes
   -linkera 5' sequence Any string is accepted An empty string is
   accepted
   -linkerb 3' sequence Any string is accepted An empty string is
   accepted
   [-outfile]
   (Parameter 3) Output file name Output file <sequence>.vectorstrip
   [-outseq]
   (Parameter 4) Output sequence(s) USA Writeable sequence(s)
   <sequence>.format
   Additional (Optional) qualifiers Allowed values Default
   (none)
   Advanced (Unprompted) qualifiers Allowed values Default
   (none)
   
Input file format

  Input files for usage example
  
  File: ../../data/vecseqs.list
  
../../data/bluescript.seq
../../data/litmus.seq
../../data/pTYB1.seq
   
  File: ../../data/vectors
  
# Example vector file for use by vectorstrip

# Vector        5'                      3'

pTYB1   GACGGCGGCCGCGAATTCC     TCGAGGGCTCTTCCTGC
pBS_KS+ GGGTACCGGGCCCCCCC       TCGAGGTCGACGGTA
pLITMUS GATATCCTGCAGGAATTCC     TCGAGACCGTACGTGCG
   
   The same fragment has been cloned into the XhoI site of the polylinker
   of each vector. The cloned fragment is represented in lower case and
   the vector sequence in upper case so the sequence trimming can be
   readily seen.
   
   Each line of the vector file should contain the name of the vector,
   the 5' pattern and the 3' pattern.
   Lines beginning with # are treated as comments and ignored.
   If only one vector sequence is given in the it will be assumed that
   this is the 5' pattern.
   If a vector name is given but no pattern data, the vector will not be
   used.
   
Output file format

  Output files for usage example
  
  File: vector.fasta
  
>pBlueScript_from_84_to_204 KS+
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>litmus.seq_from_62_to_182
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>pTYB1.seq_from_59_to_179
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
   
  File: vector.strip
  

Sequence: pBlueScript    Vector: pTYB1  No match


Sequence: pBlueScript    Vector: pBS_KS+
5' sequence matches:
        From 67 to 83 with 0 mismatches
3' sequence matches:
        From 205 to 219 with 0 mismatches
Sequences output to file:
        from 84 to 204
                tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
                cacagtgacatgagagacacagatatagagacagatagacgatagacaga
                cagcatatatagacagatagc
        sequence trimmed from 5' end:
                GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT
                AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC
        sequence trimmed from 3' end:
                TCGAGGTCGACGGTATCGATAAGCTTGATATCG


Sequence: pBlueScript    Vector: pLITMUS        No match

Sequence: litmus.seq     Vector: pTYB1  No match

Sequence: litmus.seq     Vector: pBS_KS+        No match


Sequence: litmus.seq     Vector: pLITMUS
5' sequence matches:
        From 43 to 61 with 0 mismatches
3' sequence matches:
        From 183 to 199 with 0 mismatches
Sequences output to file:
        from 62 to 182
                tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
                cacagtgacatgagagacacagatatagagacagatagacgatagacaga
                cagcatatatagacagatagc
        sequence trimmed from 5' end:
                TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT
                GCAGGAATTCC
        sequence trimmed from 3' end:
                TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG
                GCCTTAAGTGAGTCGTATTACGGA



Sequence: pTYB1.seq      Vector: pTYB1
5' sequence matches:
        From 40 to 58 with 0 mismatches
3' sequence matches:
        From 180 to 196 with 0 mismatches
Sequences output to file:
        from 59 to 179
                tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
                cacagtgacatgagagacacagatatagagacagatagacgatagacaga
                cagcatatatagacagatagc
        sequence trimmed from 5' end:
                CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG
                CGAATTCC
        sequence trimmed from 3' end:
                TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT


Sequence: pTYB1.seq      Vector: pBS_KS+        No match

Sequence: pTYB1.seq      Vector: pLITMUS        No match
   
   Two types of output file are produced:
    1. The sequence file(s) - contain the trimmed subsequence(s) produced
       by vectorstrip either all in one file, or in separate files if the
       command line flag -ossingle is used.
    2. Results summary file
       
Data files

   None.
   
Notes

   None.
   
References

   None.
   
Warnings

   None.
   
Diagnostic Error Messages

    1.
No suitable vectors found - exiting
       indicates that the 5' and 3' patterns for the vectors were blank -
       usually this is as a result of an empty vectorfile.
    2.
Illegal pattern
       indicates that one of the vector patterns could not be compiled
       and therefore cannot be searched.
    3.
5' and 3' sequence matches are identical; inconclusive
       indicates that the 5' and 3' patterns provided were identical, and
       that they only match the sequence once. Thus the program cannot
       determine which part of the sequence is vector and which is
       insert.
       
Exit status

   It always exits with status 0.
   
Known bugs

   None.
   
See also

   Program name                          Description
   biosed       Replace or delete sequence sections
   cutseq       Removes a specified section from a sequence
   degapseq     Removes gap characters from sequences
   descseq      Alter the name or description of a sequence
   entret       Reads and writes (returns) flatfile entries
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Writes a list file of the logical OR of two sets of sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Excludes a set of sequences and writes out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping the first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   union        Reads sequence fragments and builds one sequence
   yank         Reads a sequence range, appends the full USA to a list file
   
Author(s)

   Val Curwen (vac  sanger.ac.uk)
   Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge,
   CB10 1SA, UK.
   
History

   16 August 2000 - Val Curwen - Written.
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
