
                                   union 
                                      
   
   
Function

   Reads sequence fragments and builds one sequence
   
Description

   union reads in several sequences, concatenates them and writes them
   out as a single sequence.
   
   It is most useful when the input sequences are specified in a List
   file. The List file (file of sequence names) can be any set of
   sequences in files or database entries specified in the normal EMBOSS
   USA (which can include the spcification of sub-regions of the
   sequence, eg. 'em:hsfau[20,55]'). Specifying several such subregions
   in a sequence or sequences allows you to enter disjoint sequences to
   be joined.
   
Usage

   Here is a sample session with union
   
   the file 'cds.list' contains a list of the regions making up the
   coding sequence of 'embl:hsfau':
   

% union 
Reads sequence fragments and builds one sequence
Input sequence(s): @../../data/cds.list
Output sequence [hsfau1.fasta]: 
   
   Go to the input files for this example
   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence database USA
  [-outseq]            seqout     Output sequence USA

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outseq" associated qualifiers
   -osformat2           string     Output seq format
   -osextension2        string     File name extension
   -osname2             string     Base file name
   -osdirectory2        string     Output directory
   -osdbname2           string     Database name to add
   -ossingle2           boolean    Separate file for each entry
   -oufo2               string     UFO features
   -offormat2           string     Features format
   -ofname2             string     Features file name
   -ofdirectory2        string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence database USA Readable sequence(s) Required
   [-outseq]
   (Parameter 2) Output sequence USA Writeable sequence <sequence>.format
   Additional (Optional) qualifiers Allowed values Default
   (none)
   Advanced (Unprompted) qualifiers Allowed values Default
   (none)
   
Input file format

   The input can be any set of sequences in a file of multiple sequence
   entries or in a List file. The sequences are concatenated in the order
   in which they appear in the file.
   
  Input files for usage example
  
  File: ../../data/cds.list
  
tembl-id:HSFAU1[782:856]
tembl-id:HSFAU1[951:1095]
tembl-id:HSFAU1[1557:1612]
tembl-id:HSFAU1[1787:1912]
   
   You may find the program yank useful for creating List files.
   
Output file format

  Output files for usage example
  
  File: hsfau1.fasta
  
>HSFAU1 X65921.1 H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa
   
   The result is a normal sequence file containing a single sequence
   resulting from the concatenation of the input sequences.
   
Data files

   None.
   
Notes

   None.
   
References

   None.
   
Warnings

   None.
   
Diagnostic Error Messages

   None.
   
Exit status

   It always exits with status 0.
   
Known bugs

   None.
   
See also

   Program name                          Description
   biosed       Replace or delete sequence sections
   cutseq       Removes a specified section from a sequence
   degapseq     Removes gap characters from sequences
   descseq      Alter the name or description of a sequence
   entret       Reads and writes (returns) flatfile entries
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Writes a list file of the logical OR of two sets of sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Excludes a set of sequences and writes out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping the first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file
   
   You may find the program yank useful for creating List files.
   
Author(s)

   Peter Rice (pmr  ebi.ac.uk)
   Informatics Division, European Bioinformatics Institute, Wellcome
   Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
   
History

   Written (March 2002) - Peter Rice.
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
