
                                   remap 
                                      
   
   
Function

   Display a sequence with restriction cut sites, translation etc
   
Description

   The Restriction Enzyme database (REBASE) is a collection of
   information about restriction enzymes and related proteins. It
   contains published and unpublished references, recognition and
   cleavage sites, isoschizomers, commercial availability, methylation
   sensitivity, crystal and sequence data. DNA methyltransferases, homing
   endonucleases, nicking enzymes, specificity subunits and control
   proteins are also included. Most recently, putative DNA
   methyltransferases and restriction enzymes, as predicted from analysis
   of genomic sequences, are also listed.
   
   The home page of REBASE is: http://rebase.neb.com/
   
   This program uses REBASE data to find the recognition sites and/or cut
   sites of restriction enzymes in a nucleic acid sequence.
   
   This program displays the cut sites on both strands by default. It
   will optionally also display the translation of the sequence.
   
   There are many options to change the style of display to aid in making
   clear presentations.
   
   One potentially very useful option is '-flatreformat' that displays
   not only the cut sites which many other restriction cut-site programs
   will show, but also shows the recognition site.
   
   By default, only one of any group of isoschizomers (enzymes that have
   the same recognition site and cut positions) is reported (this
   behaviour can be turned off by setting the qualifier '-limit' to be
   false.) The reported enzyme from any one group of isoschizomers (the
   prototype) is specified in the REBASE database and the information is
   held in the data file 'embossre.equ'. You may edit this file to set
   your own preferred prototype,if you wish.
   
   As well as the display of where enzymes cut in the sequence, remap
   displays:
   
     * The list of enzymes that cut the sequence and match the required
       criteria.
     * The list of enzymes that cut the sequence and fail the MINCUTS
       criteria.
     * The list of enzymes that cut the sequence and fail the MAXCUTS
       criteria.
     * The list of enzymes that do not cut the sequence but which match
       all the required criteria.
     * The number of enzymes that cut the sequence and fail the SITELEN,
       BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria.
       
Usage

   Here is a sample session with remap
   
   This example uses only a small region of the input sequence to save
   space. This is run with a small test version of the restriction enzyme
   database and so you will probably see more enzymes when you run this.
   

% remap -notran -sbeg 1 -send 60 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski
Minimum recognition site length [4]: 
Output file [eclac.remap]: 
   
   Go to the input files for this example
   Go to the output files for this example
   
   Example 2
   
   This is an example where all enzymes in the REBASE database are used,
   (but only the prototypes of the isoschizomers are reported by
   default). This is run with a small test version of the restriction
   enzyme database and so you will probably see more enzymes when you run
   this.
   

% remap -notran -sbeg 1 -send 60 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 
   
   Go to the output files for this example
   
   Example 3
   
   This is an example where all enzymes in the REBASE database are used
   but the -limit qualifier is not set so that all of the enzymes are
   displayed and not just only the prototypes of the isoschizomers. This
   is run with a small test version of the restriction enzyme database
   and so you will probably see more enzymes when you run this.
   

% remap -notran -sbeg 1 -send 60 -nolimit 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 
   
   Go to the output files for this example
   
   Example 4
   
   This shows the 'flat' format: This is run with a small test version of
   the restriction enzyme database and so you will probably see more
   enzymes when you run this.
   

% remap -notran -sbeg 1 -send 60 -flat 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 
   
   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence database USA
   -enzymes            string     The name 'all' reads in all enzyme names
                                  from the REBASE database. You can specify
                                  enzymes by giving their names with commas
                                  between then, such as:
                                  'HincII,hinfI,ppiI,hindiii'.
                                  The case of the names is not important. You
                                  can specify a file of enzyme names to read
                                  in by giving the name of the file holding
                                  the enzyme names with a '@' character in
                                  front of it, for example, '@enz.list'.
                                  Blank lines and lines starting with a hash
                                  character or '!' are ignored and all other
                                  lines are concatenated together with a comma
                                  character ',' and then treated as the list
                                  of enzymes to search for.
                                  An example of a file of enzyme names is:
                                  ! my enzymes
                                  HincII, ppiII
                                  ! other enzymes
                                  hindiii
                                  HinfI
                                  PpiI
   -sitelen            integer    This sets the minimum length of the
                                  restriction enzyme recognition site. Any
                                  enzymes with sites shorter than this will be
                                  ignored.
  [-outfile]           outfile    Output file name

   Additional (Optional) qualifiers:
   -mincuts            integer    This sets the minimum number of cuts for any
                                  restriction enzyme that will be considered.
                                  Any enzymes that cut fewer times than this
                                  will be ignored.
   -maxcuts            integer    This sets the maximum number of cuts for any
                                  restriction enzyme that will be considered.
                                  Any enzymes that cut more times than this
                                  will be ignored.
   -single             boolean    If this is set then this forces the values
                                  of the mincuts and maxcuts qualifiers to
                                  both be 1. Any other value you may have set
                                  them to will be ignored.
   -[no]blunt          boolean    This allows those enzymes which cut at the
                                  same position on the forward and reverse
                                  strands to be considered.
   -[no]sticky         boolean    This allows those enzymes which cut at
                                  different positions on the forward and
                                  reverse strands, leaving an overhang, to be
                                  considered.
   -[no]ambiguity      boolean    This allows those enzymes which have one or
                                  more 'N' ambiguity codes in their pattern to
                                  be considered
   -plasmid            boolean    If this is set then this allows searches for
                                  restriction enzyme recognition site and cut
                                  postions that span the end of the sequence
                                  to be considered.
   -[no]commercial     boolean    If this is set, then only those enzymes with
                                  a commercial supplier will be searched for.
                                  This qualifier is ignored if you have
                                  specified an explicit list of enzymes to
                                  search for, rather than searching through
                                  'all' the enzymes in the REBASE database. It
                                  is assumed that, if you are asking for an
                                  explicit enzyme, then you probably know
                                  where to get it from and so all enzymes
                                  names that you have asked to be searched
                                  for, and which cut, will be reported whether
                                  or not they have a commercial supplier.
   -table              menu       Genetic code to use
   -[no]cutlist        boolean    This produces lists in the output of the
                                  enzymes that cut, those that cut but are
                                  excluded because that cut fewer times than
                                  mincut or more times than maxcut and those
                                  enzymes that do not cut.
   -flatreformat       boolean    This changes the output format to one where
                                  the recognition site is indicated by a row
                                  of '===' characters and the cut site is
                                  pointed to by a '>' character in the forward
                                  sense, or a '<' in the reverse sense
                                  strand.
   -[no]limit          boolean    This limits the reporting of enzymes to just
                                  one enzyme from each group of
                                  isoschizomers. The enzyme chosen to
                                  represent an isoschizomer group is the
                                  prototype indicated in the data file
                                  'embossre.equ', which is created by the
                                  program 'rebaseextract'. If you prefer
                                  different prototypes to be used, make a copy
                                  of embossre.equ in your home directory and
                                  edit it. If this value is set to be false
                                  then all of the input enzymes will be
                                  reported. You might like to set this to
                                  false if you are supplying an explicit set
                                  of enzymes rather than searching 'all' of
                                  them.

   Advanced (Unprompted) qualifiers:
   -[no]translation    boolean    This displays the 6-frame translations of
                                  the sequence in the output.
   -[no]reverse        boolean    This displays the cut sites and translation
                                  of the reverse sense.
   -orfminsize         integer    This sets the minimum size of Open Reading
                                  Frames (ORFs) to display in the
                                  translations. All other translation regions
                                  are masked by changing the amino acids to
                                  '-' characters.
   -uppercase          range      Regions to put in uppercase.
                                  If this is left blank, then the sequence
                                  case is left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
   -highlight          range      Regions to colour if formatting for HTML.
                                  If this is left blank, then the sequence is
                                  left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are followed by any valid HTML font
                                  colour.
                                  Examples of region specifications are:
                                  24-45 blue 56-78 orange
                                  1-100 green 120-156 red
                                  A file of ranges to colour (one range per
                                  line) can be specifed as '@filename'.
   -threeletter        boolean    Display protein sequences in three-letter
                                  code
   -number             boolean    Number the sequences
   -width              integer    Width of sequence to display
   -length             integer    Line length of page (0 for indefinite)
   -margin             integer    Margin around sequence for numbering
   -[no]name           boolean    Set this to be false if you do not wish to
                                  display the ID name of the sequence
   -[no]description    boolean    Set this to be false if you do not wish to
                                  display the description of the sequence
   -offset             integer    Offset to start numbering the sequence from
   -html               boolean    Use HTML formatting

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outfile" associated qualifiers
   -odirectory2         string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence database USA Readable sequence(s) Required
   -enzymes The name 'all' reads in all enzyme names from the REBASE
   database. You can specify enzymes by giving their names with commas
   between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the
   names is not important. You can specify a file of enzyme names to read
   in by giving the name of the file holding the enzyme names with a '@'
   character in front of it, for example, '@enz.list'. Blank lines and
   lines starting with a hash character or '!' are ignored and all other
   lines are concatenated together with a comma character ',' and then
   treated as the list of enzymes to search for. An example of a file of
   enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii
   HinfI PpiI Any string is accepted all
   -sitelen This sets the minimum length of the restriction enzyme
   recognition site. Any enzymes with sites shorter than this will be
   ignored. Integer from 2 to 20 4
   [-outfile]
   (Parameter 2) Output file name Output file <sequence>.remap
   Additional (Optional) qualifiers Allowed values Default
   -mincuts This sets the minimum number of cuts for any restriction
   enzyme that will be considered. Any enzymes that cut fewer times than
   this will be ignored. Integer from 1 to 1000 1
   -maxcuts This sets the maximum number of cuts for any restriction
   enzyme that will be considered. Any enzymes that cut more times than
   this will be ignored. Integer up to 2000000000 2000000000
   -single If this is set then this forces the values of the mincuts and
   maxcuts qualifiers to both be 1. Any other value you may have set them
   to will be ignored. Boolean value Yes/No No
   -[no]blunt This allows those enzymes which cut at the same position on
   the forward and reverse strands to be considered. Boolean value Yes/No
   Yes
   -[no]sticky This allows those enzymes which cut at different positions
   on the forward and reverse strands, leaving an overhang, to be
   considered. Boolean value Yes/No Yes
   -[no]ambiguity This allows those enzymes which have one or more 'N'
   ambiguity codes in their pattern to be considered Boolean value Yes/No
   Yes
   -plasmid If this is set then this allows searches for restriction
   enzyme recognition site and cut postions that span the end of the
   sequence to be considered. Boolean value Yes/No No
   -[no]commercial If this is set, then only those enzymes with a
   commercial supplier will be searched for. This qualifier is ignored if
   you have specified an explicit list of enzymes to search for, rather
   than searching through 'all' the enzymes in the REBASE database. It is
   assumed that, if you are asking for an explicit enzyme, then you
   probably know where to get it from and so all enzymes names that you
   have asked to be searched for, and which cut, will be reported whether
   or not they have a commercial supplier. Boolean value Yes/No Yes
   -table Genetic code to use
   0 (Standard)
   1 (Standard (with alternative initiation codons))
   2 (Vertebrate Mitochondrial)
   3 (Yeast Mitochondrial)
   4 (Mold, Protozoan, Coelenterate Mitochondrial and
   Mycoplasma/Spiroplasma)
   5 (Invertebrate Mitochondrial)
   6 (Ciliate Macronuclear and Dasycladacean)
   9 (Echinoderm Mitochondrial)
   10 (Euplotid Nuclear)
   11 (Bacterial)
   12 (Alternative Yeast Nuclear)
   13 (Ascidian Mitochondrial)
   14 (Flatworm Mitochondrial)
   15 (Blepharisma Macronuclear)
   16 (Chlorophycean Mitochondrial)
   21 (Trematode Mitochondrial)
   22 (Scenedesmus obliquus)
   23 (Thraustochytrium Mitochondrial)
   0
   -[no]cutlist This produces lists in the output of the enzymes that
   cut, those that cut but are excluded because that cut fewer times than
   mincut or more times than maxcut and those enzymes that do not cut.
   Boolean value Yes/No Yes
   -flatreformat This changes the output format to one where the
   recognition site is indicated by a row of '===' characters and the cut
   site is pointed to by a '>' character in the forward sense, or a '<'
   in the reverse sense strand. Boolean value Yes/No No
   -[no]limit This limits the reporting of enzymes to just one enzyme
   from each group of isoschizomers. The enzyme chosen to represent an
   isoschizomer group is the prototype indicated in the data file
   'embossre.equ', which is created by the program 'rebaseextract'. If
   you prefer different prototypes to be used, make a copy of
   embossre.equ in your home directory and edit it. If this value is set
   to be false then all of the input enzymes will be reported. You might
   like to set this to false if you are supplying an explicit set of
   enzymes rather than searching 'all' of them. Boolean value Yes/No Yes
   Advanced (Unprompted) qualifiers Allowed values Default
   -[no]translation This displays the 6-frame translations of the
   sequence in the output. Boolean value Yes/No Yes
   -[no]reverse This displays the cut sites and translation of the
   reverse sense. Boolean value Yes/No Yes
   -orfminsize This sets the minimum size of Open Reading Frames (ORFs)
   to display in the translations. All other translation regions are
   masked by changing the amino acids to '-' characters. Integer 0 or
   more If this value is left as 0 then all of the translation is shown.
   -uppercase Regions to put in uppercase. If this is left blank, then
   the sequence case is left alone. A set of regions is specified by a
   set of pairs of positions. The positions are integers. They are
   separated by any non-digit, non-alpha character. Examples of region
   specifications are: 24-45, 56-78 1:45, 67=99;765..888
   1,5,8,10,23,45,57,99 Sequence range If this is left blank, then the
   sequence case is left alone.
   -highlight Regions to colour if formatting for HTML. If this is left
   blank, then the sequence is left alone. A set of regions is specified
   by a set of pairs of positions. The positions are integers. They are
   followed by any valid HTML font colour. Examples of region
   specifications are: 24-45 blue 56-78 orange 1-100 green 120-156 red A
   file of ranges to colour (one range per line) can be specifed as
   '@filename'. Sequence range full sequence
   -threeletter Display protein sequences in three-letter code Boolean
   value Yes/No No
   -number Number the sequences Boolean value Yes/No No
   -width Width of sequence to display Integer 1 or more 60
   -length Line length of page (0 for indefinite) Integer 0 or more 0
   -margin Margin around sequence for numbering Integer 0 or more 10
   -[no]name Set this to be false if you do not wish to display the ID
   name of the sequence Boolean value Yes/No Yes
   -[no]description Set this to be false if you do not wish to display
   the description of the sequence Boolean value Yes/No Yes
   -offset Offset to start numbering the sequence from Any integer value
   1
   -html Use HTML formatting Boolean value Yes/No No
   
Input file format

  Input files for usage example
  
   'tembl:eclac' is a sequence entry in the example nucleic acid database
   'tembl'
   
  Database entry: tembl:eclac
  
ID   ECLAC      standard; DNA; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
SV   J01636.1
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC   Escherichia.
XX
RN   [1]
RP   1243-1266
RX   MEDLINE; 74055539.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   MEDLINE; 74055540.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN   [3]
RX   MEDLINE; 74174501.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      456
0
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      462
0
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      468
0
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      474
0
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      480
0
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      486
0
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      492
0
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      498
0
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      504
0
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      510
0
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      516
0
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      522
0
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      528
0
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      534
0
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      540
0
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      546
0
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      552
0
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      558
0
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      564
0
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      570
0
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      576
0
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      582
0
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      588
0
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      594
0
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      600
0
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      606
0
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      612
0
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      618
0
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      624
0
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      630
0
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      636
0
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      642
0
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      648
0
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      654
0
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      660
0
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      666
0
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      672
0
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      678
0
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      684
0
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      690
0
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      696
0
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      702
0
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      708
0
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      714
0
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      720
0
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      726
0
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      732
0
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      738
0
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      744
0
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               747
7
//
   
   You can specifiy a file of ranges to display in uppercase by giving
   the '-uppercase' qualifier the value '@' followed by the name of the
   file containing the ranges. (eg: '-upper @myfile').
   
   The format of the range file is:
   
     * Comment lines start with '#' in the first column.
     * Comment lines and blank lines are ignored.
     * The line may start with white-space.
     * There are two positive (integer) numbers per line separated by one
       or more space or TAB characters.
     * The second number must be greater or equal to the first number.
     * There can be optional text after the two numbers to annotate the
       line.
     * White-space before or after the text is removed.
       
   An example range file is:

# this is my set of ranges
12   23
 4   5       this is like 12-23, but smaller
67   10348   interesting region

   You can specifiy a file of ranges to highlight in a different colour
   when outputting in HTML format (using the '-html' qualifier) by giving
   the '-highlight' qualifier the value '@' followed by the name of the
   file containing the ranges. (eg: '-highlight @myfile').
   
   The format of this file is very similar to the format of the above
   uppercase range file, except that the text after the start and end
   positions is used as the HTML colour name. This colour name is used
   'as is' when specifying the colour in HTML in a '<FONT COLOR=xxx>'
   construct, (where 'xxx' is the name of the colour).
   
   The standard names of HTML font colours are given in:
   http://http://www.w3.org/TR/REC-html40/types.html and
   http://www.ausmall.com.au/freegraf/ncolour2.htm and
   http://mindprod.com/htmlcolours.html (amongst other places).
   
   An example highlight range file is:
     _________________________________________________________________
   
# this is my set of ranges
12   23         red
 4   5          darkturquoise
67   10348      #FFE4E1
     _________________________________________________________________
   
Output file format

  Output files for usage example
  
  File: eclac.remap
  
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                        BssKI
                 TaqI                 AciI              Ksp632I
                 \                    \                 \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                   /                    /                  / /
                   TaqI                 AciI               | BssKI
                                                           Ksp632I


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BssKI          1
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut




# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0
   
  Output files for usage example 2
  
  File: eclac.remap
  
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      Hin6I
                 TaqI                                 | HhaI
                 |  BsiYI                             | BssKI
                 |  |   Hin6I                         | Ksp632I
                 |  |   | HhaI        AciI            | | HpaII
                 \  \   \ \           \               \ \ \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 / /    / /             /             / /  ///
                 | TaqI | Hin6I         AciI          | |  ||BssKI
                 BsiYI  HhaI                          | |  |HpaII
                                                      | |  Ksp632I
                                                      | Hin6I
                                                      HhaI


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BsiYI          1   Bsc4I
     BssKI          1
      HhaI          2
     Hin6I          2   HinP1I,HspAI
     HpaII          1   BsiSI
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BsrI      ClaI      EcoRI     EcoRII    HaeIII

Hin4I     HindII    HindIII   KpnI      MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0
   
  Output files for usage example 3
  
  File: eclac.remap
  
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      HspAI
                 TaqI                                 Hin6I
                 |  Bsc4I                             HinP1I
                 |  |   HspAI                         | HhaI
                 |  |   Hin6I                         | BssKI
                 |  |   HinP1I                        | Bsu6I
                 |  |   | HhaI        AciI            | | BsiSI
                 \  \   \ \           \               \ \ \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 / /    / /             /             / /  ///
                 | TaqI | HinP1I        AciI          | |  ||BssKI
                 Bsc4I  | Hin6I                       | |  |BsiSI
                        | HspAI                       | |  Bsu6I
                        HhaI                          | HinP1I
                                                      | HspAI
                                                      | Hin6I
                                                      HhaI


# Enzymes that cut  Frequency
      AciI          1
     Bsc4I          1
     BsiSI          1
     BssKI          1
     Bsu6I          1
      HhaI          2
     Hin6I          2
    HinP1I          2
     HspAI          2
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency



# Enzymes that do not cut

AclI      BamHI     BceAI     Bse1I     BshI      ClaI      EcoRI     EcoRII

Hin4I     HindII    HindIII   HpyCH4IV  KpnI      NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0
   
  Output files for usage example 4
  
  File: eclac.remap
  
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                                  Ksp632I

                                                         BHpaII
                                                          >===
                        HhaI                          HhaI
                                                      ==>=
              BsiTaqI   Hin6I            AciI         Hin6I
                 >===   >===          >..====         >===
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 ===<   ===<             <===         ===<
              BsiTaqI   Hin6I            AciI         Hin6I
                                                      =<==  <.....====
                        HhaI                          HhaI        Ksp632I
                                                          ===<
                                                         BHpaII


# Enzymes that cut  Frequency   Isoschizomers
      AciI          1
     BsiYI          1   Bsc4I
     BssKI          1
      HhaI          2
     Hin6I          2   HinP1I,HspAI
     HpaII          1   BsiSI
   Ksp632I          1   Bsu6I
      TaqI          1



# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency   Isoschizomers



# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency   Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BsrI      ClaI      EcoRI     EcoRII    HaeIII

Hin4I     HindII    HindIII   KpnI      MaeII     NotI


# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria

0
   
   The name of the sequence is displayed, followed by the description of
   the sequence.
   
   The formatted display of cut sites on the sequence follows, with the
   six-frame translation below it. The cut sites are indicated by a slash
   character '\' that points to the poition between the nucleotides where
   the cuts occur. Cuts by many enzymes at the same position are
   indicated by stacking the enzyme names on top of each other.
   
   At the end the section header 'Enzymes that cut' is displayed followed
   by a list of the enzymes that cut the specified sequence and the
   number of times that they cut. For each enzyme that cuts, a list of
   isoschizomers of that enzyme (sharing the same recognition site
   pattern and cut sites) is given.
   
   This is followed by lists of the enzymes that do cut, but which cut
   less often than the '-mincut' qualifier or more often than the
   '-maxcut' qualifier.
   
   Any of the isoschizomers that are excluded from cutting, (either
   through restrictions such as the permitted number of cuts, blunt
   cutters only, single cutters only etc. or because their name has not
   been given in the input list of enzymes), will not be listed.
   
   Then a list is displayed of the enzymes whose names were input and
   which match the other criteria ('-sitelen', '-blunt', '-sticky',
   '-ambiguity' or '-commercial') but which do not cut.
   
   Finally the number of enzymes that were rejected from consideration
   because they do not match the '-sitelen', '-blunt', '-sticky',
   '-ambiguity' or '-commercial' criteria is displayed.
   
   The '-flatreformat' qualifier changes the display to emphasise the
   recognition site of the restriction enzyme, which is indicated by a
   row of '=' characters. The cut site if pointed to by a '>' or '<'
   character and if the cut site is not within or imemdiately adjacent to
   the recognition site, they are linked by a row of '.' characters.
   
   The name of the enzyme is displayed above (or below when the reverse
   sense site if displayed) the recognition site. The name of the enzyme
   is also displayed above the cut site if this occurs on a different
   display line to the recognition site (i.e. if it wraps onto the next
   line of sequence).
   
Data files

   This uses the EMBOSS REBASE data files in 'data/REBASE/*' under the
   EMBOSS installation directory.
   
   These files must first be set up using the program 'rebaseextract'.
   Running 'rebaseextract' may be the job of your system manager.
   
   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.
   
   To see the available EMBOSS data files, run:
   
% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".
   
   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata
       
   The data files are stored in the REBASE directory of the standard
   EMBOSS data directory. The names are:
     * embossre.enz Cleavage information
     * embossre.ref Reference/methylation information
     * embossre.sup Supplier information
       
   The column information is described at the top of the data files
   
   The reported enzyme from any one group of isoschizomers (the
   prototype) is specified in the REBASE database and the information is
   held in the data file 'embossre.equ'. You may edit this file to set
   your own preferred prototype,if you wish.
   
   The format of the file "embossre.equ" is
   Enzyme-name Prototype-name
   
   i.e. two columns of enzyme names separated by a space. The first name
   of the pair of enzymes is the name that is not preferred and the
   second is the preferred, prototype name.
   
Notes

   None.
   
References

   None.
   
Warnings

   None.
   
Diagnostic Error Messages

   None.
   
Exit status

   It always exits with status 0.
   
Known bugs

   None.
   
See also

   Program name Description
   abiview Reads ABI file and display the trace
   backtranseq Back translate a protein sequence
   cirdna Draws circular maps of DNA constructs
   coderet Extract CDS, mRNA and translations from feature tables
   lindna Draws linear maps of DNA constructs
   pepnet Displays proteins as a helical net
   pepwheel Shows protein sequences as helices
   plotorf Plot potential open reading frames
   prettyplot Displays aligned sequences, with colouring and boxing
   prettyseq Output sequence with translated ranges
   recoder Remove restriction sites but maintain the same translation
   redata Search REBASE for enzyme name, references, suppliers etc
   restover Finds restriction enzymes that produce a specific overhang
   restrict Finds restriction enzyme cleavage sites
   seealso Finds programs sharing group names
   showalign Displays a multiple sequence alignment
   showdb Displays information on the currently available databases
   showfeat Show features of a sequence
   showorf Pretty output of DNA translations
   showseq Display a sequence with features, translation etc
   silent Silent mutation restriction enzyme scan
   sixpack Display a DNA sequence with 6-frame translation and ORFs
   textsearch Search sequence documentation text. SRS and Entrez are
   faster!
   transeq Translate nucleic acid sequences
   
Author(s)

   Gary Williams (gwilliam  hgmp.mrc.ac.uk)
   HGMP-RC, Genome Campus, Hinxton, Cambridge CB10 1SB, UK
   
History

   Written Spring 2000
   
   Changed 7 Dec 2000 - GWW - to declare isoschizomers that cut
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
