
                                 degapseq 
                                      
   
   
Function

   Removes gap characters from sequences
   
Description

   degapseq reads in one or more sequences and writes them out again
   minus any gap characters. In effect it removes gaps from aligned
   sequences.
   
   In fact, if does more than just this as it removes ANY non-alphabetic
   character from the input sequence, so as well as removing the
   gap-characters, it will remove such things as the '*' in protein
   sequences that indicates the position of a 'translated' STOP codon.
   
   There are many different formats for storing sequences in files. Some
   sequence formats allow you to store aligned sequences, including the
   information on where gaps have been introduced to make the sequence
   align properly. This is indicated by using a special character to
   indicate that there is a gap at that position. Different sequence
   formats use different characters to indicate gaps. Some formats may
   use more than one type of character to indicate different types of
   gaps (e.g. gaps at the ends of the sequences, internal gaps, gaps
   introduced by a program or by a person editing the alignment, etc.)
   Some typicate characters used to indicate where gaps are may be: '.',
   '-' and '~'.
   
   When EMBOSS programs read in a sequence that has gap-characters in,
   all gap characters are internally changed to '-' characters. i.e.
   EMBOSS only has one type of gap character. Thus any distinguishing
   characters for different gap types are reduced to a '-'. There is only
   one type of gap in EMBOSS.
   
   degapseq removes any non-alphabetic character in the sequence, in
   effect this means that gaps and '*' characters are removed. The
   sequence is then written out.
   
Usage

   Here is a sample session with degapseq
   
   
% degapseq ../../data/dnagap.fasta nogaps.seq 
Removes gap characters from sequences

   Go to the input files for this example
   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence database USA
  [-outseq]            seqoutall  Output sequence(s) USA

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outseq" associated qualifiers
   -osformat2           string     Output seq format
   -osextension2        string     File name extension
   -osname2             string     Base file name
   -osdirectory2        string     Output directory
   -osdbname2           string     Database name to add
   -ossingle2           boolean    Separate file for each entry
   -oufo2               string     UFO features
   -offormat2           string     Features format
   -ofname2             string     Features file name
   -ofdirectory2        string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence database USA Readable sequence(s) Required
   [-outseq]
   (Parameter 2) Output sequence(s) USA Writeable sequence(s)
   <sequence>.format
   Additional (Optional) qualifiers Allowed values Default
   (none)
   Advanced (Unprompted) qualifiers Allowed values Default
   (none)
   
Input file format

   Any valid input sequence USA is allowed.
   
   The input sequence can be nucleic or protein.
   
   The input sequence can be gapped or ungapped.
   
  Input files for usage example
  
  File: ../../data/dnagap.fasta
  
>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGT
   
   hsf1 --------TGACTGATGCTGA~~~~CTG-ACGTGACTGATGCTGATCGTGACTGATCGTGAC
   >myclone1 ATGCGCAGGTACGTATGCTGACGGTACGTGATCGA-GCTGA-CGAGCGTATGC-----
   -->
   
Output file format

   The output is a sequence with no gaps.
   
  Output files for usage example
  
  File: nogaps.seq
  
>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGT
   
Data files

   None.
   
Notes

   None.
   
References

   None.
   
Warnings

   It will remove '*' characters from protein sequences as well as
   removing the gap characters.
   
Diagnostic Error Messages

   None.
   
Exit status

   It always exits with status 0.
   
Known bugs

   None.
   
See also

   Program name                          Description
   biosed       Replace or delete sequence sections
   cutseq       Removes a specified section from a sequence
   descseq      Alter the name or description of a sequence
   entret       Reads and writes (returns) flatfile entries
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Writes a list file of the logical OR of two sets of sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Excludes a set of sequences and writes out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping the first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   union        Reads sequence fragments and builds one sequence
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file
   
Author(s)

   Gary Williams (gwilliam  hgmp.mrc.ac.uk)
   HGMP-RC, Genome Campus, Hinxton, Cambridge CB10 1SB, UK
   
History

   Written (6 March 2001) - Gary Williams
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
