
                                    dan 
                                      
   
   
Function

   Calculates DNA RNA/DNA melting temperature
   
Description

   Dan calculates the melting temperature (Tm) and the percent G+C of a
   nucleic acid sequence (optionally plotting them). For the Melting
   temperature profile, free energy values calculated from nearest
   neighbor thermodynamics are used (Breslauer et al. Proc. Natl. Acad.
   Sci. USA 83, 3746-3750 and Baldino et al. Methods in Enzymol. 168,
   761-777).
   
Usage

   Here is a sample session with dan
   

% dan 
Calculates DNA RNA/DNA melting temperature
Input sequence(s): tembl:paamir
Enter window size [20]: 
Enter Shift Increment [1]: 
Enter DNA concentration (nM) [50.]: 
Enter salt concentration (mM) [50.]: 
Output report [paamir.dan]: 
   
   Go to the input files for this example
   Go to the output files for this example
   
   Example 2
   
   An example of producing a plot of Tm:
   

% dan -plot -graph cps 
Calculates DNA RNA/DNA melting temperature
Input sequence(s): tembl:paamir
Enter window size [20]: 
Enter Shift Increment [1]: 
Enter DNA concentration (nM) [50.]: 
Enter salt concentration (mM) [50.]: 
Enter minimum temperature [55.]: 

Created dan.ps
   
   Go to the output files for this example
   
Command line arguments

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Sequence database USA
   -windowsize         integer    The values of melting point and other
                                  thermodynamic properties of the sequence are
                                  determined by taking a short length of
                                  sequence known as a window and determining
                                  the properties of the sequence in that
                                  window. The window is incrementally moved
                                  along the sequence with the properties being
                                  calculated at each new position.
   -shiftincrement     integer    This is the amount by which the window is
                                  moved at each increment in order to find the
                                  melting point and other properties along
                                  the sequence.
   -dnaconc            float      Enter DNA concentration (nM)
   -saltconc           float      Enter salt concentration (mM)
*  -formamide          float      This specifies the percent formamide to be
                                  used in calculations (it is ignored unless
                                  -product is used).
*  -mismatch           float      This specifies the percent mismatch to be
                                  used in calculations (it is ignored unless
                                  -product is used).
*  -prodlen            integer    This specifies the product length to be used
                                  in calculations (it is ignored unless
                                  -product is used).
*  -mintemp            float      Enter a minimum value for the temperature
                                  scale (y-axis) of the plot.
*  -graph              xygraph    Graph type
*  -outfile            report     If a plot is not being produced then data on
                                  the melting point etc. in each window along
                                  the sequence is output to the file.

   Additional (Optional) qualifiers (* if not always prompted):
*  -temperature        float      If -thermo has been specified then this
                                  specifies the temperature at which to
                                  calculate the DeltaG, DeltaH and DeltaS
                                  values.

   Advanced (Unprompted) qualifiers:
   -rna                boolean    This specifies that the sequence is an RNA
                                  sequnce and not a DNA sequence.
   -product            boolean    This prompts for percent formamide, percent
                                  of mismatches allowed and product length.
   -thermo             boolean    Output the DeltaG, DeltaH and DeltaS values
                                  of the sequence windows to the output data
                                  file.
   -plot               boolean    If this is not specified then the file of
                                  output data is produced, else a plot of the
                                  melting point along the sequence is
                                  produced.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-graph" associated qualifiers
   -gprompt             boolean    Graph prompting
   -gtitle              string     Graph title
   -gsubtitle           string     Graph subtitle
   -gxtitle             string     Graph x axis title
   -gytitle             string     Graph y axis title
   -goutfile            string     Output file for non interactive displays
   -gdirectory          string     Output directory

   "-outfile" associated qualifiers
   -rformat             string     Report format
   -rname               string     Base file name
   -rextension          string     File name extension
   -rdirectory          string     Output directory
   -raccshow            boolean    Show accession number in the report
   -rdesshow            boolean    Show description in the report
   -rscoreshow          boolean    Show the score in the report
   -rusashow            boolean    Show the full USA in the report

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths
   

   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence database USA Readable sequence(s) Required
   -windowsize The values of melting point and other thermodynamic
   properties of the sequence are determined by taking a short length of
   sequence known as a window and determining the properties of the
   sequence in that window. The window is incrementally moved along the
   sequence with the properties being calculated at each new position.
   Integer from 1 to 100 20
   -shiftincrement This is the amount by which the window is moved at
   each increment in order to find the melting point and other properties
   along the sequence. Integer 1 or more 1
   -dnaconc Enter DNA concentration (nM) Number from 1.000 to 100000.000
   50.
   -saltconc Enter salt concentration (mM) Number from 1.000 to 1000.000
   50.
   -formamide This specifies the percent formamide to be used in
   calculations (it is ignored unless -product is used). Number from
   0.000 to 100.000 0.
   -mismatch This specifies the percent mismatch to be used in
   calculations (it is ignored unless -product is used). Number from
   0.000 to 100.000 0.
   -prodlen This specifies the product length to be used in calculations
   (it is ignored unless -product is used). Any integer value Window size
   (20)
   -mintemp Enter a minimum value for the temperature scale (y-axis) of
   the plot. Number from 0.000 to 150.000 55.
   -graph Graph type EMBOSS has a list of known devices, including
   postscript, ps, hpgl, hp7470, hp7580, meta, colourps, cps, xwindows,
   x11, tektronics, tekt, tek4107t, tek, none, null, text, data, xterm,
   png EMBOSS_GRAPHICS value, or x11
   -outfile If a plot is not being produced then data on the melting
   point etc. in each window along the sequence is output to the file.
   Report output file
   Additional (Optional) qualifiers Allowed values Default
   -temperature If -thermo has been specified then this specifies the
   temperature at which to calculate the DeltaG, DeltaH and DeltaS
   values. Number from 0.000 to 100.000 25.
   Advanced (Unprompted) qualifiers Allowed values Default
   -rna This specifies that the sequence is an RNA sequnce and not a DNA
   sequence. Boolean value Yes/No No
   -product This prompts for percent formamide, percent of mismatches
   allowed and product length. Boolean value Yes/No No
   -thermo Output the DeltaG, DeltaH and DeltaS values of the sequence
   windows to the output data file. Boolean value Yes/No No
   -plot If this is not specified then the file of output data is
   produced, else a plot of the melting point along the sequence is
   produced. Boolean value Yes/No No
   
Input file format

   Any DNA or RNA sequence USA.
   
  Input files for usage example
  
   'tembl:paamir' is a sequence entry in the example nucleic acid
   database 'tembl'
   
  Database entry: tembl:paamir
  
ID   PAAMIR     standard; DNA; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
SV   X13776.1
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   17-FEB-1997 (Rel. 50, Last updated, Version 22)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas
.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
RN   [2]
RP   1167-2167
RX   MEDLINE; 89211409.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomona
s
RT   aeruginosa";
RL   FEBS Lett. 246:39-43(1989).
XX
RN   [3]
RP   1-1292
RX   MEDLINE; 91317707.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173:4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
DR   SWISS-PROT; P10932; AMIR_PSEAE.
DR   SWISS-PROT; P27017; AMIC_PSEAE.
DR   SWISS-PROT; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   phenotype"
FT                   /replace=""
FT                   /gene="amiC"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 cause
s
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        6
0
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       12
0
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       18
0
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       24
0
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       30
0
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       36
0
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       42
0
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       48
0
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       54
0
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       60
0
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       66
0
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       72
0
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       78
0
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       84
0
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       90
0
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       96
0
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      102
0
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      108
0
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      114
0
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      120
0
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      126
0
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      132
0
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      138
0
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      144
0
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      150
0
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      156
0
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      162
0
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      168
0
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      174
0
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      180
0
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      186
0
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      192
0
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      198
0
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      204
0
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      210
0
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      216
0
     cctcgag                                                                216
7
//
   
Output file format

   If a plot is not being produced, dan reports the sequence of each
   oligomer window, its melting temperature under the specified
   conditions and its GC content.
   
   The output is a standard EMBOSS report file.
   
   The results can be output in one of several styles by using the
   command-line qualifier -rformat xxx, where 'xxx' is replaced by the
   name of the required format. The available format names are: embl,
   genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel,
   feattable, motif, regions, seqtable, simple, srs, table, tagseq
   
   See:
   http://www.uk.embnet.org/Software/EMBOSS/Themes/ReportFormats.html for
   further information on report formats.
   
   By default dan writes a 'seqtable' report file.
   
  Output files for usage example
  
  File: paamir.dan
  
########################################
# Program: dan
# Rundate: Thu Nov 27 15:18:08 2003
# Report_format: seqtable
# Report_file: paamir.dan
########################################

#=======================================
#
# Sequence: PAAMIR     from: 1   to: 2167
# HitCount: 2148
#=======================================

  Start     End     Tm     GC DeltaG DeltaH DeltaS TmProd Sequence
      1      20   64.9   70.0      .      .      .      . ggtaccgctggccgagcatc
      2      21   63.7   65.0      .      .      .      . gtaccgctggccgagcatct
      3      22   63.7   65.0      .      .      .      . taccgctggccgagcatctg
      4      23   66.9   70.0      .      .      .      . accgctggccgagcatctgc
      5      24   66.7   70.0      .      .      .      . ccgctggccgagcatctgct
      6      25   65.5   70.0      .      .      .      . cgctggccgagcatctgctc
      7      26   65.5   70.0      .      .      .      . gctggccgagcatctgctcg
      8      27   63.7   65.0      .      .      .      . ctggccgagcatctgctcga
      9      28   62.9   60.0      .      .      .      . tggccgagcatctgctcgat
     10      29   62.6   65.0      .      .      .      . ggccgagcatctgctcgatc
     11      30   61.7   60.0      .      .      .      . gccgagcatctgctcgatca
     12      31   60.2   60.0      .      .      .      . ccgagcatctgctcgatcac
     13      32   60.2   60.0      .      .      .      . cgagcatctgctcgatcacc
     14      33   59.0   55.0      .      .      .      . gagcatctgctcgatcacca
     15      34   59.2   55.0      .      .      .      . agcatctgctcgatcaccac
     16      35   60.4   60.0      .      .      .      . gcatctgctcgatcaccacc
     17      36   58.9   55.0      .      .      .      . catctgctcgatcaccacca
     18      37   58.6   55.0      .      .      .      . atctgctcgatcaccaccag
     19      38   61.3   60.0      .      .      .      . tctgctcgatcaccaccagc
     20      39   62.4   65.0      .      .      .      . ctgctcgatcaccaccagcc
     21      40   63.9   65.0      .      .      .      . tgctcgatcaccaccagccg
     22      41   64.9   70.0      .      .      .      . gctcgatcaccaccagccgg
     23      42   64.3   70.0      .      .      .      . ctcgatcaccaccagccggg
     24      43   66.1   70.0      .      .      .      . tcgatcaccaccagccgggc
     25      44   67.5   75.0      .      .      .      . cgatcaccaccagccgggcg
     26      45   66.1   70.0      .      .      .      . gatcaccaccagccgggcga
     27      46   66.3   70.0      .      .      .      . atcaccaccagccgggcgac
     28      47   68.6   75.0      .      .      .      . tcaccaccagccgggcgacg
     29      48   69.8   80.0      .      .      .      . caccaccagccgggcgacgg
     30      49   70.7   80.0      .      .      .      . accaccagccgggcgacggg
     31      50   70.5   80.0      .      .      .      . ccaccagccgggcgacggga
     32      51   68.6   75.0      .      .      .      . caccagccgggcgacgggaa
     33      52   68.6   75.0      .      .      .      . accagccgggcgacgggaac
     34      53   68.4   75.0      .      .      .      . ccagccgggcgacgggaact
     35      54   67.4   75.0      .      .      .      . cagccgggcgacgggaactg
     36      55   68.9   75.0      .      .      .      . agccgggcgacgggaactgc


  [Part of this file has been deleted for brevity]

   2101    2120   69.9   80.0      .      .      .      . ggccggagcgctgaccctgc
   2102    2121   68.7   75.0      .      .      .      . gccggagcgctgaccctgct
   2103    2122   65.5   70.0      .      .      .      . ccggagcgctgaccctgcta
   2104    2123   63.5   65.0      .      .      .      . cggagcgctgaccctgctat
   2105    2124   61.3   60.0      .      .      .      . ggagcgctgaccctgctatt
   2106    2125   60.1   60.0      .      .      .      . gagcgctgaccctgctattc
   2107    2126   61.7   60.0      .      .      .      . agcgctgaccctgctattcg
   2108    2127   63.4   65.0      .      .      .      . gcgctgaccctgctattcgc
   2109    2128   61.7   60.0      .      .      .      . cgctgaccctgctattcgct
   2110    2129   59.5   55.0      .      .      .      . gctgaccctgctattcgctt
   2111    2130   57.1   50.0      .      .      .      . ctgaccctgctattcgcttt
   2112    2131   56.4   45.0      .      .      .      . tgaccctgctattcgctttt
   2113    2132   54.7   45.0      .      .      .      . gaccctgctattcgctttta
   2114    2133   55.0   45.0      .      .      .      . accctgctattcgcttttac
   2115    2134   55.9   50.0      .      .      .      . ccctgctattcgcttttacc
   2116    2135   54.7   45.0      .      .      .      . cctgctattcgcttttacct
   2117    2136   52.0   40.0      .      .      .      . ctgctattcgcttttaccta
   2118    2137   51.2   35.0      .      .      .      . tgctattcgcttttacctat
   2119    2138   50.9   40.0      .      .      .      . gctattcgcttttacctatc
   2120    2139   49.0   35.0      .      .      .      . ctattcgcttttacctatct
   2121    2140   49.3   35.0      .      .      .      . tattcgcttttacctatctg
   2122    2141   51.1   35.0      .      .      .      . attcgcttttacctatctgt
   2123    2142   52.2   40.0      .      .      .      . ttcgcttttacctatctgtg
   2124    2143   54.0   45.0      .      .      .      . tcgcttttacctatctgtgg
   2125    2144   55.2   50.0      .      .      .      . cgcttttacctatctgtggg
   2126    2145   53.9   45.0      .      .      .      . gcttttacctatctgtgggt
   2127    2146   52.3   45.0      .      .      .      . cttttacctatctgtgggtg
   2128    2147   53.5   45.0      .      .      .      . ttttacctatctgtgggtgg
   2129    2148   56.0   50.0      .      .      .      . tttacctatctgtgggtggc
   2130    2149   57.8   55.0      .      .      .      . ttacctatctgtgggtggcc
   2131    2150   60.1   60.0      .      .      .      . tacctatctgtgggtggccg
   2132    2151   63.4   65.0      .      .      .      . acctatctgtgggtggccgc
   2133    2152   64.3   70.0      .      .      .      . cctatctgtgggtggccgcc
   2134    2153   63.4   65.0      .      .      .      . ctatctgtgggtggccgcca
   2135    2154   62.7   60.0      .      .      .      . tatctgtgggtggccgccaa
   2136    2155   64.5   65.0      .      .      .      . atctgtgggtggccgccaac
   2137    2156   66.5   70.0      .      .      .      . tctgtgggtggccgccaacc
   2138    2157   66.8   70.0      .      .      .      . ctgtgggtggccgccaacca
   2139    2158   66.8   70.0      .      .      .      . tgtgggtggccgccaaccag
   2140    2159   66.8   70.0      .      .      .      . gtgggtggccgccaaccagt
   2141    2160   65.9   65.0      .      .      .      . tgggtggccgccaaccagtt
   2142    2161   65.6   70.0      .      .      .      . gggtggccgccaaccagttc
   2143    2162   65.6   70.0      .      .      .      . ggtggccgccaaccagttcc
   2144    2163   64.4   65.0      .      .      .      . gtggccgccaaccagttcct
   2145    2164   64.1   65.0      .      .      .      . tggccgccaaccagttcctc
   2146    2165   65.4   70.0      .      .      .      . ggccgccaaccagttcctcg
   2147    2166   64.2   65.0      .      .      .      . gccgccaaccagttcctcga
   2148    2167   62.4   65.0      .      .      .      . ccgccaaccagttcctcgag

#---------------------------------------
#---------------------------------------
   
  Output files for usage example 2
  
  Graphics File: dan.ps
  
   [dan results]
   
  File: paamir.dan
  
   The header information contains details of the program, date and
   sequence
   
   Subsequent lines contain columns of data for each window into the
   sequence as it is moved along, giving:
   
     * The start postion of the window
     * The end position of the window
     * The melting temperature of the window
     * The percentage C+G of the window
     * The sequence of the window
       
   If the qualifier '-product' is used to make the program prompt for
   percent formamide percent of mismatches allowed and product length,
   then the output includes the melting temperature of the specified
   product.
   
   If the qualifier '-thermo' is gived then the DeltaG, DeltaH and DeltaS
   of the sequence in the window is also output.
   
Data files

   The EMBOSS data files "Edna.melt" and "Erna.melt" are used to read in
   the entropy/enthalpy/energy data for DNA and RNA respectively.
   
   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by EMBOSS
   environment variable EMBOSS_DATA.
   
   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".
   
   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata
       
Notes

   None.
   
References

    1. Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986).
       "Predicting DNA Duplex Stability from the Base Sequence."
       Proceedings of the National Academy of Sciences USA 83, 3746-3750.
    2. Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization
       Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168,
       761-777, Academic Press, San Diego, California, USA.
       
Warnings

   RNA sequences must be submited to this application with the '-rna'
   qualifier on the command line, otherwise the sequence will be assumed
   to be DNA.
   
Diagnostic Error Messages

   None.
   
Exit status

   0 if successful.
   
Known bugs

   None.
   
See also

   Program name                          Description
   banana       Bending and curvature plot in B-DNA
   btwisted     Calculates the twisting in a B-DNA sequence
   chaos        Create a chaos game representation plot for a sequence
   compseq      Counts the composition of dimer/trimer/etc words in a sequence
   freak        Residue/base frequency table or plot
   isochore     Plots isochores in large DNA sequences
   sirna        Finds siRNA duplexes in mRNA
   wordcount    Counts words of a specified size in a DNA sequence
   
Author(s)

   This program was originally included in EGCG under the names "MELT"
   and "MELTPLOT", written by Rodrigo Lopez (rls  ebi.ac.uk)
   European Bioinformatics Institute, Wellcome Trust Genome Campus,
   Hinxton, Cambridge CB10 1SD, UK
   
   This application was written by Alan Bleasby
   (ableasby  hgmp.mrc.ac.uk)
   HGMP-RC, Genome Campus, Hinxton, Cambridge CB10 1SB, UK
   
History

   Written (1999) - Alan Bleasby
   
Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.
   
Comments
