|
|
primersearch |
The user can specify a maximum percent mismatch level; for example, 10% mismatch on a primer of length 20bp means that the program will classify a primer as matching a sequence if 18 of the 20 base pairs matches.
It will only report matches if both primers in the pair have a match in opposite orientations.
% primersearch tembl:z52466 Searches DNA sequences for matches with primer pairs Primer file: ../../data/primers Allowed percent mismatch [0]: Output file [hsa203yc1.primersearch]: |
Go to the input files for this example
Go to the output files for this example
Example 2
Here we run the same example but allowing 20% mismatch between the primers and the sequence:
% primersearch tembl:z52466 Searches DNA sequences for matches with primer pairs Primer file: ../../data/primers Allowed percent mismatch [0]: 20 Output file [hsa203yc1.primersearch]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-seqall] seqall Sequence database USA
[-primersfile] infile Primer file
[-mismatchpercent] integer Allowed percent mismatch
[-outfile] outfile Output file name
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-seqall" associated qualifiers
-sbegin1 integer First base used
-send1 integer Last base used, def=seq length
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory4 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-seqall] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-primersfile] (Parameter 2) |
Primer file | Input file | Required |
| [-mismatchpercent] (Parameter 3) |
Allowed percent mismatch | Any integer value | 0 |
| [-outfile] (Parameter 4) |
Output file name | Output file | <sequence>.primersearch |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
# This is my primer file D1S243 cacacaggctcacatgcc gctccagcgtcatggact D1S468 aattaaccgttttggtcct gcgacacacacttccc D1S2845 ccaaagggtgcttctc gtggcattccaacctc D1S1608 gatggcttttggggactatt cactgagccaagtgacacag D1S2893 aaaacatcaactctcccctg ctcaaaccccaataagcctt D1S2660 cacacatgcacatgcac agtgacaccagcaggg |
ID HSA203YC1 standard; DNA; STS; 389 BP.
XX
AC Z52466;
XX
SV Z52466.1
XX
DT 18-MAR-1996 (Rel. 47, Created)
DT 23-MAR-1996 (Rel. 47, Last updated, Version 3)
XX
DE H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1;
DE single read.
XX
KW CA repeat; dinucleotide repeat; GT repeat; microsatellite DNA;
KW microsatellite marker; repeat polymorphism; STS.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN [1]
RP 1-389
RA Weissenbach J.;
RT ;
RL Submitted (01-SEP-1995) to the EMBL/GenBank/DDBJ databases.
RL Genethon, B.P. 60, 91002 Evry Cedex France. E-mail:
RL Jean.Weissenbach@genethon.fr
XX
RN [2]
RP 1-389
RX MEDLINE; 96176476.
RA Dib C., Faure S., Fizames C., Samson D., Drouot N., Vignal A.,
RA Millasseau P., Marc S., Hazan J., Seboun E., Lathrop M., Gyapay G.,
RA Morissette J., Weissenbach J.;
RT "A comprehensive genetic map of the human genome based on 5,264
RT microsatellites";
RL Nature 380:152-154(1996).
XX
CC full automatic;
XX
FH Key Location/Qualifiers
FH
FT source 1..389
FT /chromosome="1"
FT /db_xref="taxon:9606"
FT /note="cloning vector is M13mp18"
FT /organism="Homo sapiens"
FT /cell_line="CEPH 134702"
FT /clone_lib="genomic DNA"
XX
SQ Sequence 389 BP; 118 A; 124 C; 86 G; 57 T; 4 other;
agctgtgtgc acacaacatg anggggcaca catgcacatg cacacatgcc cacatgcata 60
tgcacacaca cacacacaca cacacacaca ttcatgccca agcacgccca ccctcatgtc 120
tcaccatgtg cacataacac acagtcacat ataccctggc acacatgccc acatgcagac 180
acgaaacaca ggcccacgnt tncatgcaca caggtatggg cacacatacc atgcacacat 240
aangacaaat accaggccag acatgatttg cccctgctgg tgtcactgtt aagtgtgaca 300
gacaagcaga ggacacacac ccacctggga cgcggggctt caggagagag gcagacctaa 360
tagggcccgg attcggggct ggggaggct 389
//
|
The input primer file has the following format:
Comment lines start with a '#'
Lines with primer information have three fields separated by spaces or TAB characters. The columns contain:
Empty files will cause primersearch to note that no primers have been found, and to exit.
Primer name D1S243 Primer name D1S468 Primer name D1S2845 Primer name D1S1608 Primer name D1S2893 Primer name D1S2660 Amplimer 1 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp |
Primer name D1S243 Primer name D1S468 Primer name D1S2845 Primer name D1S1608 Primer name D1S2893 Primer name D1S2660 Amplimer 1 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 239 bp Amplimer 2 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp |
Each primer pair consists of a name, followed by two primer sequences, primerA and primerB. The program first compares primerA to the forward strand and if it matches, primerB is compared to the reverse strand. The approach is then reversed, with the primerB being compared to the forward strand and primerA to the reverse. In this way all possible amplimers are reported.
| Program name | Description |
|---|---|
| eprimer3 | Picks PCR primers and hybridization oligos |
| stssearch | Searches a DNA database for matches with a set of STS primers |