|
|
nthseq |
This default behaviour can be changed by using the qualifier '-ossingle' which writes many sequences into many files, each containing one sequence.
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.
If, however you have the situation where you have a file containing multiple sequences and you wish to extract one of them, then this application may be useful.
nthseq allows you to specify the name of the output file, so you may find that it is useful to include this program in scripts where you need to be able to specify the name of the resulting sequence files you create.
This application extracts the indicated sequence from a multiple set of sequences and writes it out.
% nthseq Writes one sequence from a multiple set of sequences Input sequence(s): tembl:eclac* The number of the sequence to output [1]: 2 Output sequence [eclac.fasta]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence database USA
-number integer The number of the sequence to output
[-outseq] seqout Output sequence USA
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer First base used
-send1 integer Last base used, def=seq length
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| -number | The number of the sequence to output | Integer 1 or more | 1 |
| [-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
In the example, the second sequence from the input file will be written out to the specified output file.
>ECLACA X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc cgcccatggtaaccaccggcagagcggtcgac |
For example:
#!/usr/local/bin/perl -w
if ($#ARGV !=1) {
die "Usage: scriptname in out\n";
}
$count=1;
@list = `infoseq $ARGV[0] -auto -only -name`;
while ($count <= $#list+1) {
system("nthseq -auto $ARGV[0] -n $count $ARGV[1]-$count.seq");
$count++;
}
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping the first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.