|
|
abiview |
The data for each nucleotide is plotted and the assigned nucleotide (G, A, T, C or N) in the ABI file is overlayed on the graphs.
It also writes out the sequence to an output sequence file.
% abiview -graph cps Reads ABI file and display the trace ABI trace file: ../../data/abiview.abi Output sequence [abiview.fasta]: Created abiview.ps |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-infile] infile ABI trace file
[-outseq] seqout Output sequence USA
-graph xygraph Graph type
Additional (Optional) qualifiers:
-startbase integer First base to report or display
-endbase integer Last sequence base to report or display. If
the default is set to zero then the value of
this is taken as the maximum number of
bases.
-yticks boolean Display y-axis ticks
-[no]sequence boolean Display the sequence on the graph
-window integer Sequence display window size
-bases string Base graphs to be displayed
Advanced (Unprompted) qualifiers:
-separate boolean Separate the trace graphs for the 4 bases
Associated qualifiers:
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
"-graph" associated qualifiers
-gprompt boolean Graph prompting
-gtitle string Graph title
-gsubtitle string Graph subtitle
-gxtitle string Graph x axis title
-gytitle string Graph y axis title
-goutfile string Output file for non interactive displays
-gdirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-infile] (Parameter 1) |
ABI trace file | Input file | Required |
| [-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
| -graph | Graph type | EMBOSS has a list of known devices, including postscript, ps, hpgl, hp7470, hp7580, meta, colourps, cps, xwindows, x11, tektronics, tekt, tek4107t, tek, none, null, text, data, xterm, png | EMBOSS_GRAPHICS value, or x11 |
| Additional (Optional) qualifiers | Allowed values | Default | |
| -startbase | First base to report or display | Integer 0 or more | 0 |
| -endbase | Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. | Any integer value | 0 |
| -yticks | Display y-axis ticks | Boolean value Yes/No | No |
| -[no]sequence | Display the sequence on the graph | Boolean value Yes/No | Yes |
| -window | Sequence display window size | Any integer value | 40 |
| -bases | Base graphs to be displayed | Any string is accepted | GATC |
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -separate | Separate the trace graphs for the 4 bases | Boolean value Yes/No | No |
This file contains non-printing characters and so cannot be displayed here.
This file contains non-printing characters and so cannot be displayed here.
>../../data/abiview.abi GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT |
The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.
| Program name | Description |
|---|---|
| cirdna | Draws circular maps of DNA constructs |
| lindna | Draws linear maps of DNA constructs |
| pepnet | Displays proteins as a helical net |
| pepwheel | Shows protein sequences as helices |
| prettyplot | Displays aligned sequences, with colouring and boxing |
| prettyseq | Output sequence with translated ranges |
| remap | Display a sequence with restriction cut sites, translation etc |
| seealso | Finds programs sharing group names |
| showalign | Displays a multiple sequence alignment |
| showdb | Displays information on the currently available databases |
| showfeat | Show features of a sequence |
| showseq | Display a sequence with features, translation etc |
| sixpack | Display a DNA sequence with 6-frame translation and ORFs |
| textsearch | Search sequence documentation text. SRS and Entrez are faster! |