
                               supermatcher 



Function

   Match large sequences against one or more other sequences

Description

   This is a rough and ready local alignment program for large sequences.
   The reason it is rough and ready is that wordmatch is used to find all
   the word matches between the first sequence and another sequence. Then
   by calculating the highest score for a diagonal we can then use this
   as the centre point for a Smith-Waterman type calculation of a width
   given by the user. So a narrow diagonal Smith-Waterman is calculated
   hence the results will be rough but due to the space saving much
   larger sequences can be aligned.

Usage

   Here is a sample session with supermatcher


% supermatcher tembl:ec* tembl:eclac -word 50  
Match large sequences against one or more other sequences
Gap opening penalty [10.0]: 
Gap extension penalty [0.5]: 3.0
Output alignment [eclac.supermatcher]: 

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-asequence]         seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-bsequence]         seqset     Sequence set filename and optional format,
                                  or reference (input USA)
   -gapopen            float      [10.0 for any sequence type] Gap opening
                                  penalty (Number from 0.000 to 100.000)
   -gapextend          float      [0.5 for any sequence type] Gap extension
                                  penalty (Number from 0.000 to 10.000)
  [-outfile]           align      Output alignment file name

   Additional (Optional) qualifiers:
   -datafile           matrixf    [EBLOSUM62 for protein, EDNAFULL for DNA]
                                  This is the scoring matrix file used when
                                  comparing sequences. By default it is the
                                  file 'EBLOSUM62' (for proteins) or the file
                                  'EDNAFULL' (for nucleic sequences). These
                                  files are found in the 'data' directory of
                                  the EMBOSS installation.
   -width              integer    [16] Alignment width (Integer 1 or more)
   -wordlen            integer    [6] Word length for initial matching
                                  (Integer 3 or more)
   -errorfile          outfile    [supermatcher.error] Error file to be
                                  written to

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-asequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-bsequence" associated qualifiers
   -sbegin2            integer    Start of each sequence to be used
   -send2              integer    End of each sequence to be used
   -sreverse2          boolean    Reverse (if DNA)
   -sask2              boolean    Ask for begin/end/reverse
   -snucleotide2       boolean    Sequence is nucleotide
   -sprotein2          boolean    Sequence is protein
   -slower2            boolean    Make lower case
   -supper2            boolean    Make upper case
   -sformat2           string     Input sequence format
   -sdbname2           string     Database name
   -sid2               string     Entryname
   -ufo2               string     UFO features
   -fformat2           string     Features format
   -fopenfile2         string     Features file name

   "-outfile" associated qualifiers
   -aformat3           string     Alignment format
   -aextension3        string     File name extension
   -adirectory3        string     Output directory
   -aname3             string     Base file name
   -awidth3            integer    Alignment width
   -aaccshow3          boolean    Show accession number in the header
   -adesshow3          boolean    Show description in the header
   -ausashow3          boolean    Show the full USA in the alignment
   -aglobal3           boolean    Show the full sequence in alignment

   "-errorfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   supermatcher reads two sequence USAs of the same type. They must both
   be protein or both be nucleic acid sequences.

  Input files for usage example

   'tembl:ec*' is a sequence entry in the example nucleic acid database
   'tembl'

  Database entry: tembl:eclac

ID   ECLAC      standard; DNA; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
SV   J01636.1
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC   Escherichia.
XX
RN   [1]
RP   1243-1266
RX   MEDLINE; 74055539.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   MEDLINE; 74055540.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN   [3]
RX   MEDLINE; 74174501.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      456
0
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      462
0
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      468
0
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      474
0
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      480
0
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      486
0
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      492
0
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      498
0
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      504
0
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      510
0
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      516
0
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      522
0
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      528
0
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      534
0
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      540
0
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      546
0
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      552
0
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      558
0
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      564
0
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      570
0
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      576
0
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      582
0
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      588
0
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      594
0
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      600
0
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      606
0
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      612
0
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      618
0
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      624
0
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      630
0
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      636
0
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      642
0
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      648
0
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      654
0
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      660
0
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      666
0
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      672
0
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      678
0
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      684
0
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      690
0
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      696
0
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      702
0
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      708
0
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      714
0
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      720
0
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      726
0
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      732
0
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      738
0
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      744
0
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               747
7
//

Output file format

   The output is a standard EMBOSS alignment file.

   The results can be output in one of several styles by using the
   command-line qualifier -aformat xxx, where 'xxx' is replaced by the
   name of the required format. Some of the alignment formats can cope
   with an unlimited number of sequences, while others are only for pairs
   of sequences.

   The available multiple alignment format names are: unknown, multiple,
   simple, fasta, msf, trace, srs

   The available pairwise alignment format names are: pair, markx0,
   markx1, markx2, markx3, markx10, srspair, score

   See: http://emboss.sf.net/docs/themes/AlignFormats.html for further
   information on alignment formats.

   The output alignment is in simple format by default.

  Output files for usage example

  File: supermatcher.error

  File: eclac.supermatcher

########################################
# Program: supermatcher
# Rundate: Sat Jul 15 2006 12:00:00
# Commandline: supermatcher
#    [-asequence] tembl:ec*
#    [-bsequence] tembl:eclac
#    -wordlen 50
#    -gapextend 3.0
# Align_format: simple
# Report_file: eclac.supermatcher
########################################

#=======================================
#
# Aligned_sequences: 2
# 1: ECLAC
# 2: ECLAC
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 3.0
#
# Length: 7477
# Identity:    7477/7477 (100.0%)
# Similarity:  7477/7477 (100.0%)
# Gaps:           0/7477 ( 0.0%)
# Score: 37385.0
#
#
#=======================================

ECLAC              1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC              1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc     50

ECLAC             51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC             51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg    100

ECLAC            101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC            101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg    150

ECLAC            151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC            151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc    200

ECLAC            201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC            201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg    250



  [Part of this file has been deleted for brevity]

ECLACZ          2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   2550
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt   3836

ECLACZ          2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   2600
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac   3886

ECLACZ          2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   2650
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc   3936

ECLACZ          2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   2700
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta   3986

ECLACZ          2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   2750
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg   4036

ECLACZ          2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   2800
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg   4086

ECLACZ          2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   2850
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag   4136

ECLACZ          2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   2900
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact   4186

ECLACZ          2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   2950
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc   4236

ECLACZ          2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   3000
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc   4286

ECLACZ          3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   3050
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC           4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca   4336

ECLACZ          3051 gttggtctggtgtcaaaaataataataa   3078
                     ||||||||||||||||||||||||||||
ECLAC           4337 gttggtctggtgtcaaaaataataataa   4364


#---------------------------------------
#---------------------------------------

   The file 'supermatcher.error' will contain any errors that occured
   during the program. This may be that wordmatch could not find any
   matches hence no suitable start point is found for the smith-waterman
   calculation.

Data files

   For protein sequences EBLOSUM62 is used for the substitution matrix.
   For nucleotide sequence, EDNAMAT is used. Others can be specified.

   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.

   To see the available EMBOSS data files, run:

% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".

   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata

Notes

   The time this program takes to do an alignment depends very much on
   the word size. For short sequences a short word size (e.g. 4) can make
   it take a very long time. Large word sizes (e.g. 30) for sequences
   that are very similar give a very quick result. The default of 16
   should give reasonable fast alignments.

   Because it does a Smith & Waterman alignment (albeit in a narrow
   region around the diagonal shown to be the 'best' by a word match),
   this program can use huge amounts of memory if the sequences are
   large.

   Because the alignment is made within a narrow area each side of the
   'best' diagonal, if there are sufficient indels between the two
   sequences, then the path of the Smith & Waterman alignment can wander
   outside of this area. Making the width larger can avoid this problem,
   but you then use more memory.

   The longer the sequences and the wider the specified alignment width,
   the more memory will be used.

   If the program terminates due to lack of memory you can try the
   following:

   Run the UNIX command 'limit' to see if your stack or memory usage have
   been limited and if so, run 'unlimit', (e.g.: '% unlimit stacksize').

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with a status of 0.

Known bugs

   None.

See also

   Program name                         Description
   matcher      Finds the best local alignments between two sequences
   seqmatchall  All-against-all comparison of a set of sequences
   water        Smith-Waterman local alignment
   wordmatch    Finds all exact matches of a given size between 2 sequences

Author(s)

   Ian Longden (il  sanger.ac.uk)
   Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge,
   CB10 1SA, UK.

History

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
