
                                 eprimer3 



Function

   Picks PCR primers and hybridization oligos

Description

   eprimer3 is an interface to the 'primer3' program from the Whitehead
   Institute.

   The Whitehead program must be set up and on the path in order for
   eprimer3 to find and run it.

   Primer3 picks primers for PCR reactions, considering as criteria:

     * oligonucleotide melting temperature, size, GC content, and
       primer-dimer possibilities,
     * PCR product size,
     * positional constraints within the source sequence, and
     * miscellaneous other constraints.

   All of these criteria are user-specifiable as constraints.

   eprimer3 can also pick hybridisation oligos that are internal to the
   product.

  ADVICE FOR PICKING PRIMERS

   We suggest referring to: Wojciech Rychlik, "Selection of Primers for
   Polymerase Chain Reaction" in BA White, Ed., "Methods in Molecular
   Biology, Vol. 15: PCR Protocols: Current Methods and Applications",
   1993, pp 31-40, Humana Press, Totowa NJ

    Cautions

   Some of the most important issues in primer picking can be addressed
   only before using eprimer3. These are sequence quality (including
   making sure the sequence is not vector and not chimeric) and avoiding
   repetitive elements.

   Techniques for avoiding problems include a thorough understanding of
   possible vector contaminants and cloning artifacts coupled with
   database searches using blast, fasta, or other similarity searching
   program to screen for vector contaminants and possible repeats.
   Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996,
   ftp://ncbi.nlm.nih.gov/repository/repbase) is an excellent source of
   repeat sequences and pointers to the literature. eprimer3 now allows
   you to screen candidate oligos against a Mispriming Library (or a
   Mishyb Library in the case of internal oligos).

   Sequence quality can be controlled by manual trace viewing and quality
   clipping or automatic quality clipping programs. Low- quality bases
   should be changed to N's or can be made part of Excluded Regions. The
   beginning of a sequencing read is often problematic because of primer
   peaks, and the end of the read often contains many low-quality or even
   meaningless called bases. Therefore when picking primers from
   single-pass sequence it is often best to use the INCLUDED_REGION
   parameter to ensure that eprimer3 chooses primers in the high quality
   region of the read.

   In addition, eprimer3 takes as input a Sequence Quality list for use
   with those base calling programs

   (e.g. Phred, Bass/Grace, Trout) that output this information.

    What to do if eprimer3 cannot find a primers?

   Try relaxing various parameters, including the self-complementarity
   parameters and max and min oligo melting temperatures. For example,
   for very A-T-rich regions you might have to increase maximum primer
   size or decrease minimum melting temperature. It is usually unwise to
   reduce the minimum primer size if your template is complex (e.g. a
   mammalian genome), since small primers are more likely to be
   non-specific. Make sure that there are adequate stretches of non-Ns in
   the regions in which you wish to pick primers. If necessary you can
   also allow an N in your primer and use an oligo mixture containing all
   four bases at that position.

   Try setting the '-explain' option.

Usage

   Here is a sample session with eprimer3


% eprimer3 tembl:hsfau1 hsfau.eprimer3 -explain 
Picks PCR primers and hybridization oligos

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     The sequence from which to choose primers.
                                  The sequence must be presented 5' to 3'
  [-outfile]           outfile    [*.eprimer3] Whitehead primer3_core program
                                  output file

   Additional (Optional) qualifiers (* if not always prompted):
   -[no]primer         toggle     [Y] Tell EPrimer3 to pick primer(s)
*  -task               menu       [1] Tell EPrimer3 what task to perform.
                                  Legal values are 1: 'Pick PCR primers', 2:
                                  'Pick forward primer only', 3: 'Pick reverse
                                  primer only', 4: 'No primers needed'.
                                  (Values: 1 (Pick PCR primers); 2 (Pick
                                  forward primer only); 3 (Pick reverse primer
                                  only); 4 (No primers needed))
   -hybridprobe        toggle     [N] An 'internal oligo' is intended to be
                                  used as a hybridization probe (hyb probe) to
                                  detect the PCR product after amplification.
*  -oligomishyblibraryfile infile     Similar to MISPRIMING-LIBRARY, except tha
t
                                  the event we seek to avoid is hybridization
                                  of the internal oligo to sequences in this
                                  library rather than priming from them.
                                  The file must be in (a slightly restricted)
                                  FASTA format (W. B. Pearson and D.J. Lipman,
                                  PNAS 85:8 pp 2444-2448 [1988]); we briefly
                                  discuss the organization of this file below.
                                  If this parameter is specified then
                                  EPrimer3 locally aligns each candidate oligo
                                  against each library sequence and rejects
                                  those primers for which the local alignment
                                  score times a specified weight (see below)
                                  exceeds INTERNAL-OLIGO-MAX-MISHYB. (The
                                  maximum value of the weight is arbitrarily
                                  set to 12.0.)
                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that EPrimer3
                                  parses everything after any optional
                                  asterisk ('*') as a floating point number to
                                  use as the weight mentioned above. If the
                                  id line contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no library should be used.
   -numreturn          integer    [5] The maximum number of primer pairs to
                                  return. Primer pairs returned are sorted by
                                  their 'quality', in other words by the value
                                  of the objective function (where a lower
                                  number indicates a better primer pair).
                                  Caution: setting this parameter to a large
                                  value will increase running time. (Integer 0
                                  or more)
   -includedregion     range      [(full sequence)] A sub-region of the given
                                  sequence in which to pick primers. For
                                  example, often the first dozen or so bases
                                  of a sequence are vector, and should be
                                  excluded from consideration. The value for
                                  this parameter has the form
                                  (start),(end)
                                  where (start) is the index of the first base
                                  to consider, and (end) is the last in the
                                  primer-picking region.
   -target             range      [(full sequence)] If one or more Targets is
                                  specified then a legal primer pair must
                                  flank at least one of them. A Target might
                                  be a simple sequence repeat site (for
                                  example a CA repeat) or a single-base-pair
                                  polymorphism. The value should be a
                                  space-separated list of
                                  (start),(end)
                                  pairs where (start) is the index of the
                                  first base of a Target, and (end) is the
                                  last
                                  E.g. 50,51 requires primers to surround the
                                  2 bases at positions 50 and 51.
   -excludedregion     range      [(full sequence)] Primer oligos may not
                                  overlap any region specified in this tag.
                                  The associated value must be a
                                  space-separated list of
                                  (start),(end)
                                  pairs where (start) is the index of the
                                  first base of the excluded region, and and
                                  (end) is the last. This tag is useful for
                                  tasks such as excluding regions of low
                                  sequence quality or for excluding regions
                                  containing repetitive elements such as ALUs
                                  or LINEs.
                                  E.g. 401,407 68,70 forbids selection of
                                  primers in the 7 bases starting at 401 and
                                  the 3 bases at 68.
   -forwardinput       string     The sequence of a forward primer to check
                                  and around which to design reverse primers
                                  and optional internal oligos. Must be a
                                  substring of SEQUENCE. (Any string is
                                  accepted)
   -reverseinput       string     The sequence of a reverse primer to check
                                  and around which to design forward primers
                                  and optional internal oligos. Must be a
                                  substring of the reverse strand of SEQUENCE.
                                  (Any string is accepted)
*  -gcclamp            integer    [0] Require the specified number of
                                  consecutive Gs and Cs at the 3' end of both
                                  the forward and reverse primer. (This
                                  parameter has no effect on the internal
                                  oligo if one is requested.) (Integer 0 or
                                  more)
*  -osize              integer    [20] Optimum length (in bases) of a primer
                                  oligo. EPrimer3 will attempt to pick primers
                                  close to this length. (Integer 0 or more)
*  -minsize            integer    [18] Minimum acceptable length of a primer.
                                  Must be greater than 0 and less than or
                                  equal to MAX-SIZE. (Integer 1 or more)
*  -maxsize            integer    [27] Maximum acceptable length (in bases) of
                                  a primer. Currently this parameter cannot
                                  be larger than 35. This limit is governed by
                                  the maximum oligo size for which EPrimer3's
                                  melting-temperature is valid. (Integer up
                                  to 35)
*  -otm                float      [60.0] Optimum melting temperature(Celsius)
                                  for a primer oligo. EPrimer3 will try to
                                  pick primers with melting temperatures are
                                  close to this temperature. The oligo melting
                                  temperature formula in EPrimer3 is that
                                  given in Rychlik, Spencer and Rhoads,
                                  Nucleic Acids Research, vol 18, num 12, pp
                                  6409-6412 and Breslauer, Frank, Bloeker and
                                  Marky, Proc. Natl. Acad. Sci. USA, vol 83,
                                  pp 3746-3750. Please refer to the former
                                  paper for background discussion. (Any
                                  numeric value)
*  -mintm              float      [57.0] Minimum acceptable melting
                                  temperature(Celsius) for a primer oligo.
                                  (Any numeric value)
*  -maxtm              float      [63.0] Maximum acceptable melting
                                  temperature(Celsius) for a primer oligo.
                                  (Any numeric value)
*  -maxdifftm          float      [100.0] Maximum acceptable (unsigned)
                                  difference between the melting temperatures
                                  of the forward and reverse primers. (Any
                                  numeric value)
*  -ogcpercent         float      [50.0] Primer optimum GC percent. (Any
                                  numeric value)
*  -mingc              float      [20.0] Minimum allowable percentage of Gs
                                  and Cs in any primer. (Any numeric value)
*  -maxgc              float      [80.0] Maximum allowable percentage of Gs
                                  and Cs in any primer generated by Primer.
                                  (Any numeric value)
*  -saltconc           float      [50.0] The millimolar concentration of salt
                                  (usually KCl) in the PCR. EPrimer3 uses this
                                  argument to calculate oligo melting
                                  temperatures. (Any numeric value)
*  -dnaconc            float      [50.0] The nanomolar concentration of
                                  annealing oligos in the PCR. EPrimer3 uses
                                  this argument to calculate oligo melting
                                  temperatures. The default (50nM) works well
                                  with the standard protocol used at the
                                  Whitehead/MIT Center for Genome
                                  Research--0.5 microliters of 20 micromolar
                                  concentration for each primer oligo in a 20
                                  microliter reaction with 10 nanograms
                                  template, 0.025 units/microliter Taq
                                  polymerase in 0.1 mM each dNTP, 1.5mM MgCl2,
                                  50mM KCl, 10mM Tris-HCL (pH 9.3) using 35
                                  cycles with an annealing temperature of 56
                                  degrees Celsius. This parameter corresponds
                                  to 'c' in Rychlik, Spencer and Rhoads'
                                  equation (ii) (Nucleic Acids Research, vol
                                  18, num 12) where a suitable value (for a
                                  lower initial concentration of template) is
                                  'empirically determined'. The value of this
                                  parameter is less than the actual
                                  concentration of oligos in the reaction
                                  because it is the concentration of annealing
                                  oligos, which in turn depends on the amount
                                  of template (including PCR product) in a
                                  given cycle. This concentration increases a
                                  great deal during a PCR; fortunately PCR
                                  seems quite robust for a variety of oligo
                                  melting temperatures.
                                  See ADVICE FOR PICKING PRIMERS. (Any numeric
                                  value)
*  -maxpolyx           integer    [5] The maximum allowable length of a
                                  mononucleotide repeat in a primer, for
                                  example AAAAAA. (Integer 0 or more)
*  -productosize       integer    [200] The optimum size for the PCR product.
                                  0 indicates that there is no optimum product
                                  size. (Integer 0 or more)
*  -productsizerange   range      [100-300] The associated values specify the
                                  lengths of the product that the user wants
                                  the primers to create, and is a space
                                  separated list of elements of the form
                                  (x)-(y)
                                  where an (x)-(y) pair is a legal range of
                                  lengths for the product. For example, if one
                                  wants PCR products to be between 100 to 150
                                  bases (inclusive) then one would set this
                                  parameter to 100-150. If one desires PCR
                                  products in either the range from 100 to 150
                                  bases or in the range from 200 to 250 bases
                                  then one would set this parameter to
                                  100-150 200-250.
                                  EPrimer3 favors ranges to the left side of
                                  the parameter string. EPrimer3 will return
                                  legal primers pairs in the first range
                                  regardless the value of the objective
                                  function for these pairs. Only if there are
                                  an insufficient number of primers in the
                                  first range will EPrimer3 return primers in
                                  a subsequent range.
*  -productotm         float      [0.0] The optimum melting temperature for
                                  the PCR product. 0 indicates that there is
                                  no optimum temperature. (Any numeric value)
*  -productmintm       float      [-1000000.0] The minimum allowed melting
                                  temperature of the amplicon. Please see the
                                  documentation on the maximum melting
                                  temperature of the product for details. (Any
                                  numeric value)
*  -productmaxtm       float      [1000000.0] The maximum allowed melting
                                  temperature of the amplicon. Product Tm is
                                  calculated using the formula from Bolton and
                                  McCarthy, PNAS 84:1390 (1962) as presented
                                  in Sambrook, Fritsch and Maniatis, Molecular
                                  Cloning, p 11.46 (1989, CSHL Press).
                                  Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) -
                                  600/length
                                  Where [Na+} is the molar sodium
                                  concentration, (%GC) is the percent of Gs
                                  and Cs in the sequence, and length is the
                                  length of the sequence.
                                  A similar formula is used by the prime
                                  primer selection program in GCG
                                  http://www.gcg.com), which instead uses
                                  675.0/length in the last term (after F.
                                  Baldino, Jr, M.-F. Chesselet, and M.E.
                                  Lewis, Methods in Enzymology 168:766 (1989)
                                  eqn (1) on page 766 without the mismatch and
                                  formamide terms). The formulas here and in
                                  Baldino et al. assume Na+ rather than K+.
                                  According to J.G. Wetmur, Critical Reviews
                                  in BioChem. and Mol. Bio. 26:227 (1991) 50
                                  mM K+ should be equivalent in these formulae
                                  to .2 M Na+. EPrimer3 uses the same salt
                                  concentration value for calculating both the
                                  primer melting temperature and the oligo
                                  melting temperature. If you are planning to
                                  use the PCR product for hybridization later
                                  this behavior will not give you the Tm under
                                  hybridization conditions. (Any numeric
                                  value)
*  -oligoexcludedregion range      [(full sequence)] Middle oligos may not
                                  overlap any region specified by this tag.
                                  The associated value must be a
                                  space-separated list of
                                  (start),(end)
                                  pairs, where (start) is the index of the
                                  first base of an excluded region, and (end)
                                  is the last. Often one would make Target
                                  regions excluded regions for internal
                                  oligos.
*  -oligoinput         string     The sequence of an internal oligo to check
                                  and around which to design forward and
                                  reverse primers. Must be a substring of
                                  SEQUENCE. (Any string is accepted)
*  -oligoosize         integer    [20] Optimum length (in bases) of an
                                  internal oligo. EPrimer3 will attempt to
                                  pick primers close to this length. (Integer
                                  0 or more)
*  -oligominsize       integer    [18] Minimum acceptable length of an
                                  internal oligo. Must be greater than 0 and
                                  less than or equal to
                                  INTERNAL-OLIGO-MAX-SIZE. (Integer 0 or more)
*  -oligomaxsize       integer    [27] Maximum acceptable length (in bases) of
                                  an internal oligo. Currently this parameter
                                  cannot be larger than 35. This limit is
                                  governed by maximum oligo size for which
                                  EPrimer3's melting-temperature is valid.
                                  (Integer up to 35)
*  -oligootm           float      [60.0] Optimum melting temperature (Celsius)
                                  for an internal oligo. EPrimer3 will try to
                                  pick oligos with melting temperatures that
                                  are close to this temperature. The oligo
                                  melting temperature formula in EPrimer3 is
                                  that given in Rychlik, Spencer and Rhoads,
                                  Nucleic Acids Research, vol 18, num 12, pp
                                  6409-6412 and Breslauer, Frank, Bloeker and
                                  Marky, Proc. Natl. Acad. Sci. USA, vol 83,
                                  pp 3746-3750. Please refer to the former
                                  paper for background discussion. (Any
                                  numeric value)
*  -oligomintm         float      [57.0] Minimum acceptable melting
                                  temperature(Celsius) for an internal oligo.
                                  (Any numeric value)
*  -oligomaxtm         float      [63.0] Maximum acceptable melting
                                  temperature (Celsius) for an internal oligo.
                                  (Any numeric value)
*  -oligoogcpercent    float      [50.0] Internal oligo optimum GC percent.
                                  (Any numeric value)
*  -oligomingc         float      [20.0] Minimum allowable percentage of Gs
                                  and Cs in an internal oligo. (Any numeric
                                  value)
*  -oligomaxgc         float      [80.0] Maximum allowable percentage of Gs
                                  and Cs in any internal oligo generated by
                                  Primer. (Any numeric value)
*  -oligosaltconc      float      [50.0] The millimolar concentration of salt
                                  (usually KCl) in the hybridization. EPrimer3
                                  uses this argument to calculate internal
                                  oligo melting temperatures. (Any numeric
                                  value)
*  -oligodnaconc       float      [50.0] The nanomolar concentration of
                                  annealing internal oligo in the
                                  hybridization. (Any numeric value)
*  -oligoselfany       float      [12.00] The maximum allowable local
                                  alignment score when testing an internal
                                  oligo for (local) self-complementarity.
                                  Local self-complementarity is taken to
                                  predict the tendency of oligos to anneal to
                                  themselves The scoring system gives 1.00 for
                                  complementary bases, -0.25 for a match of
                                  any base (or N) with an N, -1.00 for a
                                  mismatch, and -2.00 for a gap. Only
                                  single-base-pair gaps are allowed. For
                                  example, the alignment
                                  5' ATCGNA 3'
                                  || | |
                                  3' TA-CGT 5'
                                  is allowed (and yields a score of 1.75), but
                                  the alignment
                                  5' ATCCGNA 3'
                                  || | |
                                  3' TA--CGT 5'
                                  is not considered. Scores are non-negative,
                                  and a score of 0.00 indicates that there is
                                  no reasonable local alignment between two
                                  oligos. (Number up to 9999.990)
*  -oligoselfend       float      [12.00] The maximum allowable 3'-anchored
                                  global alignment score when testing a single
                                  oligo for self-complementarity.
                                  The scoring system is as for the Maximum
                                  Complementarity argument. In the examples
                                  above the scores are 7.00 and 6.00
                                  respectively. Scores are non-negative, and a
                                  score of 0.00 indicates that there is no
                                  reasonable 3'-anchored global alignment
                                  between two oligos. In order to estimate
                                  3'-anchored global alignments for candidate
                                  oligos, Primer assumes that the sequence
                                  from which to choose oligos is presented 5'
                                  to 3'.
                                  INTERNAL-OLIGO-SELF-END is meaningless when
                                  applied to internal oligos used for
                                  hybridization-based detection, since
                                  primer-dimer will not occur. We recommend
                                  that INTERNAL-OLIGO-SELF-END be set at least
                                  as high as INTERNAL-OLIGO-SELF-ANY. (Number
                                  up to 9999.990)
*  -oligomaxpolyx      integer    [5] The maximum allowable length of an
                                  internal oligo mononucleotide repeat, for
                                  example AAAAAA. (Integer 0 or more)
*  -oligomaxmishyb     float      [12.0] Similar to MAX-MISPRIMING except that
                                  this parameter applies to the similarity of
                                  candidate internal oligos to the library
                                  specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
                                  (Number up to 9999.990)

   Advanced (Unprompted) qualifiers:
   -mispriminglibraryfile infile     The name of a file containing a nucleotide
                                  sequence library of sequences to avoid
                                  amplifying (for example repetitive
                                  sequences, or possibly the sequences of
                                  genes in a gene family that should not be
                                  amplified.) The file must be in (a slightly
                                  restricted) FASTA format (W. B. Pearson and
                                  D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]);
                                  we briefly discuss the organization of this
                                  file below. If this parameter is specified
                                  then EPrimer3 locally aligns each candidate
                                  primer against each library sequence and
                                  rejects those primers for which the local
                                  alignment score times a specified weight
                                  (see below) exceeds MAX-MISPRIMING. (The
                                  maximum value of the weight is arbitrarily
                                  set to 100.0.)
                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that EPrimer3
                                  parses everything after any optional
                                  asterisk ('*') as a floating point number to
                                  use as the weight mentioned above. If the
                                  id line contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no repeat library should be used.
   -explainflag        boolean    [N] If this flag is true, produce
                                  LEFT-EXPLAIN, RIGHT-EXPLAIN, and
                                  INTERNAL-OLIGO-EXPLAIN output tags, which
                                  are intended to provide information on the
                                  number of oligos and primer pairs that
                                  EPrimer3 examined, and statistics on the
                                  number discarded for various reasons.
   -fileflag           boolean    [N] If the associated value is true, then
                                  EPrimer3 creates two output files for each
                                  input SEQUENCE. File (sequence-id).for lists
                                  all acceptable forward primers for
                                  (sequence-id), and (sequence-id).rev lists
                                  all acceptable reverse primers for
                                  (sequence-id), where (sequence-id) is the
                                  value of the SEQUENCE-ID tag (which must be
                                  supplied). In addition, if the input tag
                                  TASK is 1 or 4, EPrimer3 produces a file
                                  (sequence-id).int, which lists all
                                  acceptable internal oligos.
   -firstbaseindex     integer    [1] This parameter is the index of the first
                                  base in the input sequence. For input and
                                  output using 1-based indexing (such as that
                                  used in GenBank and to which many users are
                                  accustomed) set this parameter to 1. For
                                  input and output using 0-based indexing set
                                  this parameter to 0. (This parameter also
                                  affects the indexes in the contents of the
                                  files produced when the primer file flag is
                                  set.) (Any integer value)
   -pickanyway         boolean    [N] If true pick a primer pair even if
                                  LEFT-INPUT, RIGHT-INPUT, or
                                  INTERNAL-OLIGO-INPUT violates specific
                                  constraints.
   -maxmispriming      float      [12.00] The maximum allowed weighted
                                  similarity with any sequence in
                                  MISPRIMING-LIBRARY. (Number up to 9999.990)
   -pairmaxmispriming  float      [24.00] The maximum allowed sum of weighted
                                  similarities of a primer pair (one
                                  similarity for each primer) with any single
                                  sequence in MISPRIMING-LIBRARY. (Number up
                                  to 9999.990)
   -numnsaccepted      integer    [0] Maximum number of unknown bases (N)
                                  allowable in any primer. (Integer 0 or more)
   -selfany            float      [8.00] The maximum allowable local alignment
                                  score when testing a single primer for
                                  (local) self-complementarity and the maximum
                                  allowable local alignment score when
                                  testing for complementarity between forward
                                  and reverse primers. Local
                                  self-complementarity is taken to predict the
                                  tendency of primers to anneal to each other
                                  without necessarily causing self-priming in
                                  the PCR. The scoring system gives 1.00 for
                                  complementary bases, -0.25 for a match of
                                  any base (or N) with an N, -1.00 for a
                                  mismatch, and -2.00 for a gap. Only
                                  single-base-pair gaps are allowed. For
                                  example, the alignment
                                  5' ATCGNA 3'
                                  ...|| | |
                                  3' TA-CGT 5'
                                  is allowed (and yields a score of 1.75), but
                                  the alignment
                                  5' ATCCGNA 3'
                                  ...|| | |
                                  3' TA--CGT 5'
                                  is not considered. Scores are non-negative,
                                  and a score of 0.00 indicates that there is
                                  no reasonable local alignment between two
                                  oligos. (Number from 0.000 to 9999.990)
   -selfend            float      [3.00] The maximum allowable 3'-anchored
                                  global alignment score when testing a single
                                  primer for self-complementarity, and the
                                  maximum allowable 3'-anchored global
                                  alignment score when testing for
                                  complementarity between forward and reverse
                                  primers. The 3'-anchored global alignment
                                  score is taken to predict the likelihood of
                                  PCR-priming primer-dimers, for example
                                  5' ATGCCCTAGCTTCCGGATG 3'
                                  .............||| |||||
                                  ..........3' AAGTCCTACATTTAGCCTAGT 5'
                                  or
                                  5' AGGCTATGGGCCTCGCGA 3'
                                  ...............||||||
                                  ............3' AGCGCTCCGGGTATCGGA 5'
                                  The scoring system is as for the Maximum
                                  Complementarity argument. In the examples
                                  above the scores are 7.00 and 6.00
                                  respectively. Scores are non-negative, and a
                                  score of 0.00 indicates that there is no
                                  reasonable 3'-anchored global alignment
                                  between two oligos. In order to estimate
                                  3'-anchored global alignments for candidate
                                  primers and primer pairs, Primer assumes
                                  that the sequence from which to choose
                                  primers is presented 5' to 3'. It is
                                  nonsensical to provide a larger value for
                                  this parameter than for the Maximum (local)
                                  Complementarity parameter because the score
                                  of a local alignment will always be at least
                                  as great as the score of a global
                                  alignment. (Number 0.000 or more)
   -maxendstability    float      [9.0] The maximum stability for the five 3'
                                  bases of a forward or reverse primer. Bigger
                                  numbers mean more stable 3' ends. The value
                                  is the maximum delta G for duplex
                                  disruption for the five 3' bases as
                                  calculated using the nearest neighbor
                                  parameters published in Breslauer, Frank,
                                  Bloeker and Marky, Proc. Natl. Acad. Sci.
                                  USA, vol 83, pp 3746-3750. EPrimer3 uses a
                                  completely permissive default value for
                                  backward compatibility (which we may change
                                  in the next release). Rychlik recommends a
                                  maximum value of 9 (Wojciech Rychlik,
                                  'Selection of Primers for Polymerase Chain
                                  Reaction' in BA White, Ed., 'Methods in
                                  Molecular Biology, Vol. 15: PCR Protocols:
                                  Current Methods and Applications', 1993, pp
                                  31-40, Humana Press, Totowa NJ). (Number up
                                  to 1000.000)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   eprimer3 reads a normal nucleic acid sequence USA.

  Input files for usage example

   'tembl:hsfau1' is a sequence entry in the example nucleic acid
   database 'tembl'

  Database entry: tembl:hsfau1

ID   HSFAU1     standard; DNA; HUM; 2016 BP.
XX
AC   X65921; S45242;
XX
SV   X65921.1
XX
DT   13-MAY-1992 (Rel. 31, Created)
DT   21-JUL-1993 (Rel. 36, Last updated, Version 5)
XX
DE   H.sapiens fau 1 gene
XX
KW   fau 1 gene.
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia
;
OC   Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN   [1]
RP   1-2016
RA   Kas K.;
RT   ;
RL   Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL   K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL   Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN   [2]
RP   1-2016
RX   MEDLINE; 92412144.
RA   Kas K., Michiels L., Merregaert J.;
RT   "Genomic structure and expression of the human fau gene: encoding the
RT   ribosomal protein S30 fused to a ubiquitin-like protein.";
RL   Biochem. Biophys. Res. Commun. 187:927-933(1992).
XX
DR   SWISS-PROT; P35544; UBIM_HUMAN.
DR   SWISS-PROT; Q05472; RS30_HUMAN.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..2016
FT                   /db_xref="taxon:9606"
FT                   /organism="Homo sapiens"
FT                   /clone_lib="CML cosmid"
FT                   /clone="15.1"
FT   mRNA            join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT                   /gene="fau 1"
FT   exon            408..504
FT                   /number=1
FT   intron          505..773
FT                   /number=1
FT   exon            774..856


  [Part of this file has been deleted for brevity]

FT                   RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT   intron          857..950
FT                   /number=2
FT   exon            951..1095
FT                   /number=3
FT   intron          1096..1556
FT                   /number=3
FT   exon            1557..1612
FT                   /number=4
FT   intron          1613..1786
FT                   /number=4
FT   exon            1787..>1912
FT                   /number=5
FT   polyA_signal    1938..1943
XX
SQ   Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
     ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac        6
0
     ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac       12
0
     tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt       18
0
     agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta       24
0
     gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg       30
0
     tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag       36
0
     gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca       42
0
     cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc       48
0
     gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg       54
0
     tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg       60
0
     tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc       66
0
     cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct       72
0
     ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa       78
0
     tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac       84
0
     ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct       90
0
     tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag       96
0
     cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg      102
0
     aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag      108
0
     gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag      114
0
     tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc      120
0
     tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg      126
0
     tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct      132
0
     ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt      138
0
     agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg      144
0
     ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt      150
0
     ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa      156
0
     agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga      162
0
     gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg      168
0
     ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag      174
0
     gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga      180
0
     gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt      186
0
     caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg      192
0
     taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt      198
0
     tacttgcaag gcctcaggga gaggtgtgct tctcgg                                201
6
//

Output file format

  Output files for usage example

  File: hsfau.eprimer3


# EPRIMER3 RESULTS FOR HSFAU1

# FORWARD PRIMER STATISTICS:
# considered 16422
# GC content failed 156
# low tm 3616
# high tm 9306
# high any compl 9
# high end compl 26
# long poly-x seq 45
#high 3' stability 304
# ok 2960

# REVERSE PRIMER STATISTICS:
# considered 16330
# GC content failed 161
# low tm 3580
# high tm 9309
# high any compl 2
# high end compl 9
# long poly-x seq 66
#high 3' stability 301
# ok 2902

# PRIMER PAIR STATISTICS:
# considered 2652
# unacceptable product size 2444
# high any compl 2
# high end compl 20
# ok 186

#                      Start  Len   Tm     GC%   Sequence

   1 PRODUCT SIZE: 202
     FORWARD PRIMER     801   20  59.72  60.00  CCCAGGAGCTACACACCTTC

     REVERSE PRIMER     983   20  59.81  55.00  GGAGCACGACTTGATCTTCC


   2 PRODUCT SIZE: 203
     FORWARD PRIMER    1810   20  59.43  55.00  GAAGAAGACAGGTCGGGCTA

     REVERSE PRIMER    1993   20  59.99  60.00  GAAGCACACCTCTCCCTGAG


   3 PRODUCT SIZE: 204
     FORWARD PRIMER    1810   20  59.43  55.00  GAAGAAGACAGGTCGGGCTA

     REVERSE PRIMER    1994   20  59.99  55.00  AGAAGCACACCTCTCCCTGA


   4 PRODUCT SIZE: 196
     FORWARD PRIMER    1266   20  59.43  60.00  GGGAGACTGAGCCAGAGTGT

     REVERSE PRIMER    1442   20  60.06  50.00  GCGCCCAATAGGTAATGAGA


   5 PRODUCT SIZE: 205
     FORWARD PRIMER     801   20  59.72  60.00  CCCAGGAGCTACACACCTTC

     REVERSE PRIMER     986   20  60.41  55.00  CCAGGAGCACGACTTGATCT



   If the '-explain' flag has been used, as in the example, then
   statistics are output describing the number of primers that were
   considered and rejected for various reasons.

   Headers describing the input file name and the names of the output
   columns are displayed.

   The best 5 primer pairs are displayed with the product size.

   The reverse sequence is displayed as the reverse complement to the
   input forward sense sequence.

   The 'Start' positions are given counting from the start of the
   sequence for both the forward and reverse primer (and for the internal
   oligos).

   Note that if you compare the results to the output from the public
   Primer3 web site you will see a difference in the reverse primer
   positions - this is because the original Primer3 program reports the
   reverse primer positions as counted from the 3' end. The convention in
   EMBOSS is to report both forward and reverse features as counted from
   the 5' end, so the reverse primer positions are given counted from the
   5' start of the sequence.

Data files

   None.

Notes

   The Whitehead Institute's primer3 program is not part of this program,
   but it must be set up on your system and on your path.

   The Whitehead Institute program that is run by this program is
   available from:
   http://www-genome.wi.mit.edu/genome_software/other/primer3.html
   (Then see the link 'Get release 0.9')

   The version that is run by this program is 3.0.9 currently available
   from:
   http://www-genome.wi.mit.edu/ftp/distribution/software/primer3_0_9_tes
   t.tar.gz The Whitehead Institute's primer3 program is:
   Copyright (c) 1996,1997,1998
   Whitehead Institute for Biomedical Research. All rights reserved.

   The Whitehead Institute requests that use of this software be cited in
   publications as:

   Steve Rozen, Helen J. Skaletsky (1996,1997,1998)
   Primer3. Code available at
   http://www-genome.wi.mit.edu/genome_software/other/primer3.html

References

   None.

Warnings

   None.

Diagnostic Error Messages

   The message: "EMBOSS An error in eprimer3.c at line 315: The program
   'primer3_core' must be on the path. It is part of the 'primer3'
   package, available from the Whitehead Institute. See:
   http://www-genome.wi.mit.edu/" is output if you do not have the
   Whitehead Institute's primer3 program set up and on your path.

Exit status

   It always exits with status 0.

Known bugs

   None.

See also

   Program name                         Description
   primersearch Searches DNA sequences for matches with primer pairs
   stssearch    Search a DNA database for matches with a set of STS primers

History

Author(s)

   Gary Williams (gwilliam  rfcgr.mrc.ac.uk)
   MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
   Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

   Written (Dec 2001) - Gary Williams

   Changed name (version 2.3.0) - Gary Williams

   When I wrote the EMBOSS wrapper for the Whitehead's primer3 version
   3.0.9 program, I called it 'primer3'. This did not conflict with the
   Whitehead program becuase although the package is called 'primer3' the
   program itself is called primer3_core.

   I wasn't aware that the Whitehead's primer3 version 3.0.6 program was
   itself called 'primer3'. This caused a name conflict in those sites
   with version 3.0.6 installed.

   To avoid the conflict, the EMBOSS program was renamed 'eprimer3'.
   eprimer3 was released in version 2.3.0 of EMBOSS

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
