
                                  abiview 



Function

   Reads ABI file and display the trace

Description

   abiview reads in an ABI sequence trace file and graphically displays
   the results.

   The data for each nucleotide is plotted and the assigned nucleotide
   (G, A, T, C or N) in the ABI file is overlayed on the graphs.

   It also writes out the sequence to an output sequence file.

Usage

   Here is a sample session with abiview


% abiview -graph cps 
Reads ABI file and display the trace
ABI sequencing trace file: abiview.abi
nucleotide output sequence [abiview.fasta]: 

Created abiview.ps

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-infile]            infile     ABI sequencing trace file
  [-outseq]            seqout     [.] Nucleotide sequence
                                  filename and optional format (output USA)
   -graph              xygraph    [$EMBOSS_GRAPHICS value, or x11] Graph type
                                  (ps, hpgl, hp7470, hp7580, meta, cps, x11,
                                  tekt, tek, none, data, xterm, png)

   Additional (Optional) qualifiers:
   -startbase          integer    [0] First base to report or display (Integer
                                  0 or more)
   -endbase            integer    [0] Last sequence base to report or display.
                                  If the default is set to zero then the
                                  value of this is taken as the maximum number
                                  of bases. (Any integer value)
   -yticks             boolean    [N] Display y-axis ticks
   -[no]sequence       boolean    [Y] Display the sequence on the graph
   -window             integer    [40] Sequence display window size (Any
                                  integer value)
   -bases              string     [GATC] Base graphs to be displayed (Any
                                  string is accepted, matching regular
                                  expression /[GATC]+/)

   Advanced (Unprompted) qualifiers:
   -separate           boolean    [N] Separate the trace graphs for the 4
                                  bases

   Associated qualifiers:

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   "-graph" associated qualifiers
   -gprompt            boolean    Graph prompting
   -gtitle             string     Graph title
   -gsubtitle          string     Graph subtitle
   -gxtitle            string     Graph x axis title
   -gytitle            string     Graph y axis title
   -goutfile           string     Output file for non interactive displays
   -gdirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   This reads in a standard ABI trace file.

  Input files for usage example

  File: abiview.abi

   This file contains non-printing characters and so cannot be displayed
   here.

  File: abiview.abi

   This file contains non-printing characters and so cannot be displayed
   here.

Output file format

   It outputs a file holding a normal nucleotide sequence.

  Output files for usage example

  File: abiview.fasta

>../../data/abiview.abi
GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA
NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA
CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC
ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG
CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT
AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC
CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG
ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA
AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT
ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA
GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG
TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA
TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT
TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT

  Graphics File: abiview.ps

   [abiview results]

   The horizontal scale of the output image labelled 'Residue Position'
   is only a very approximate indication of the spacing of residues in
   the image. The real residue spacing is variable, as it relies on the
   speed with which the oligo-nucleotides are eluted in the ABI
   sequencer. Do not be surprised to see the nucleotide signals spaced at
   a much greater distance than the horizontal scale might suggest.

Data files

   None.

Notes

   None.

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with status 0.

Known bugs

   None.

See also

   Program name                        Description
   cirdna       Draws circular maps of DNA constructs
   lindna       Draws linear maps of DNA constructs
   pepnet       Displays proteins as a helical net
   pepwheel     Shows protein sequences as helices
   prettyplot   Displays aligned sequences, with colouring and boxing
   prettyseq    Output sequence with translated ranges
   remap        Display sequence with restriction sites, translation etc
   seealso      Finds programs sharing group names
   showalign    Displays a multiple sequence alignment
   showdb       Displays information on the currently available databases
   showfeat     Show features of a sequence
   showseq      Display a sequence with features, translation etc
   sixpack      Display a DNA sequence with 6-frame translation and ORFs
   textsearch   Search sequence documentation. Slow, use SRS and Entrez!

Author(s)

   Tim Carver (tcarver  rfcgr.mrc.ac.uk)
   MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
   Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

   Written (January 2001) - Tim Carver

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
