
Bioperl FAQ
-----------
v. 1.5.1

This FAQ maintained by:
* Jason Stajich <jason@bioperl.org>
* Brian Osborne <brian_osborne@cognia.com>
* Heikki Lehvaslaiho <heikki@ebi.ac.uk>


---------------------------------------------------------------------------

Contents

---------------------------------------------------------------------------

0. About this FAQ

   Q0.1: What is this FAQ?
   Q0.2: How is it maintained?

1. Bioperl in general

   Q1.1: What is Bioperl?
   Q1.2: Where do I go to get the latest release?
   Q1.3: What is the difference between 0.9.x and 0.7.x? What do you mean
	 developer release?
   Q1.4: Is it BioPerl, bioperl, bio.perl.org, Bioperl?  What's the deal?
   Q1.5: How do I figure out how to use a module?
   Q1.6: I'm interested in the bleeding edge version of the code, where can
	 I get it?
   Q1.7: Who uses this toolkit?
   Q1.8: How should I cite Bioperl?
   Q1.9: What are the license terms for Bioperl?
  Q1.10: I want to help, where do I start?
  Q1.11: I've got an idea for a module how do I contribute it?
  Q1.12: Why can't I easily get a list of all the methods a object can
	 call?
  Q1.13: Can you explain the Object Model design and rationale?

2. Sequences

   Q2.1: How do I parse a sequence file?
   Q2.2: I can't get sequences with Bio::DB::GenBank any more, why not?
   Q2.3: How can I get NT_ or NM_ or NP_ accessions from NCBI
		 (Reference Sequences)?
   Q2.4: How can I use SeqIO to parse sequence data to or from a string?
   Q2.5: I'm using Bio::Index::Fasta in order to retrieve sequences from my
	 indexed fasta file but I keep seeing ">> MSG: Did not provide a
	 valid Bio::PrimarySeqI object" when I call fetch() followed by
	 SeqIO::write_seq(). Why?
   Q2.6: I'm using Bio::DB::GenBank to query Genbank and I'm certain that
	 the id is there but I'm seeing the error "MSG: acc does not
	 exist".

3. Report parsing

   Q3.1: I want to parse BLAST, how do I do this?
   Q3.2: What was wrong with Bio::Tools::Blast?
   Q3.3: I want to parse FastA or NCBI -m7 (XML) format, how do I do this?
   Q3.4: Let's say I want to do pairwise alignments of 2 sequences. How can
	 I do this?
   Q3.5: I'm using Bio::Search* and its frame() to parse Blast but I'm
	 seeing 0, 1, or 2 instead of the expected -3, -2, -1, +1, +2, +3.
	 Why am I seeing these different numbers and how do I get the frame
	 according to Blast?
   Q3.6: How do I tell BLAST to search multiple database using
	 Bio::Tools::Run::StandAloneBlast?
   Q3.7: Can I get domain number from hmmpfam or hmmsearch output? E.g.
		   SH2_5: domain 2 of 2, from 349 to 432: score 104.4, E =
	 1.9e-26
   Q3.8: Does SearchIO parse the HTML output that BLAST creates?

4. Utilities

   Q4.1: How do I find all the ORFs in a nucleotide sequence? Antigenic
	 sites in a protein? Calculate nucleotide melting temperature? Find
	 repeats?
   Q4.2: How do I do motif searches with Bioperl? Can I do "find all
	 sequences that are 75% identical" to a given motif?
   Q4.3: Can I query MEDLINE or other bibliographic repositories using
	 Bioperl?

5. Annotations and Features

   Q5.1: I get the warning "(old style Annotation) on new style
	 Annotation::Collection".  What is wrong?
   Q5.2: How do I retrieve all the features from a Sequence?  How about all
	 the features which are exons or have a /note field that contains a
	 certain gene name?
   Q5.3: How do I parse the CDS join() or complement() statements in
	 Genbank or EMBL files to get the sub-locations, like the
	 coordinates "45" and "122" in "join(45..122,233..267)"?
   Q5.4: How do I retrieve a nucleotide coding sequence when I have a
	 protein gi number?
   Q5.5: How do I get the complete spliced nucleotide sequence from the CDS
	 section?
   Q5.6: How do I get the reverse-complement of a sequence using the
	 subseq() method?

6. Running external programs

   Q6.1: How do I run Blast from within Bioperl?
   Q6.2: Hey, I want to run clustalw within Bioperl, I used
	 Bio::Tools::Run::Alignment::Clustalw before - where did it go?
   Q6.3: What does the future hold for running applications within Bioperl?
   Q6.4: I'm trying to run StandAloneBlast and I'm seeing error messages
	 like "Can't locate Bio/Tools/Run/WrapperBase.pm". How do I fix
	 this?

7. Other Bioperl packages

   Q7.1: What is bioperl-ext?
   Q7.2: I can't seem to get bioperl-ext to compile the staden IO lib part,
	 what do I do?


---------------------------------------------------------------------------

0. About this FAQ

---------------------------------------------------------------------------



   Q0.1: What is this FAQ?

      A: It is the list of Frequently Asked Questions about Bioperl.


   Q0.2: How is it maintained?

      A: This FAQ was generated using a Perl script and an XML file. All
	 the files are in the Bioperl distribution directory doc/faq. So do
	 not edit this file! Edit file faq.xml and run:

	 % faq.pl -text faq.xml

	 The XML structure was originally used by the Perl XML project.
	 Their website seems to have vanished, though. The XML and
	 modifying scripts were copied from Michael Rodriguez's web site
	 http://www.xmltwig.com/xmltwig/XML-Twig-FAQ.html and modified to
	 our needs.


---------------------------------------------------------------------------

1. Bioperl in general

---------------------------------------------------------------------------



   Q1.1: What is Bioperl?

      A: Bioperl is a toolkit of perl modules useful in building
	 bioinformatics solutions in perl. It is built in an
	 object-oriented manner so that many modules depend on each other
	 to achieve a task. The collection of modules in the bioperl-live
	 repository consist of the core of the functionality of bioperl.
	 Additionally auxiliary modules for creating graphical interfaces
	 (bioperl-gui), persistent storage in RDMBS (bioperl-db), running
	 and parsing the results from hundreds of bioinformatics
	 applications (bioperl-run), software to automate bioinformatic
	 analyses (bioperl-pipeline), and CORBA bridges to the BioCORBA
	 (http://www.biocorba.org) specification (bioperl-corba-server and
	 bioperl-corba-client) are all available as CVS modules in our
	 repository.


   Q1.2: Where do I go to get the latest release?

      A: You can always get our releases from ftp://bioperl.org/pub/DIST.
	 Official releases will be noted on the website http://bioperl.org.


   Q1.3: What is the difference between 0.9.x and 0.7.x? What do you mean
	 developer release?

      A: 0.7.X series (0.7.0, 0.7.2) were all released in 2001 and were
	 stable releases on 0.7 branch.  This means they had a set of
	 functionality that is maintained throughout (no experimental
	 modules) and were guaranteed to have all tests and subsequent bug
	 fix releases with the 0.7 designation would not have any API
	 changes.

	 The 0.9.X series was our first attempt at releasing so called
	 developer releases.  These are snapshots of the actively developed
	 code that at a minimum pass all our tests.

	 But really, you should be using version 1.21 or greater!


   Q1.4: Is it BioPerl, bioperl, bio.perl.org, Bioperl?  What's the deal?

      A: Well, the perl.org guys granted us use of bio.perl.org. We prefer
	 to be called Bioperl or BioPerl (unlike our Biopython friends). 
	 We're part of the Open Bioinformatics Foundation (OBF) and so as
	 part of the Bio{*} toolkits we prefer the Bioperl spelling.  But
	 we're not really all that picky so no worries. 


   Q1.5: How do I figure out how to use a module?

      A: A good list of the documentation can be found at
	 http://bio.perl.org/Core/Latest/modules.html. Read the embedded
	 perl documentation (Plain Old Documentation - POD) that is part of
	 every modules.  Do:

	 % perldoc MODULE

	 Careful - spelling and case count!

	 The bioperl tutorial - bptutorial.pl - provided in the root
	 directory of the bioperl release will also provide a good
	 introduction.	You may also find useful documentation in the form
	 of a HOWTO in the bioperl package or at
	 http://www.bioperl.org/HOWTOs. There are links to tutorials off
	 the bioperl website that may provide some additional help.

	 There are also many scripts in the examples/ and scripts/
	 directories that could be useful - see bioscripts.pod for a brief
	 description of all of them.

	 Additionally we have written many tests for our modules, you can
	 see test data and example usage of the modules in these tests -
	 look in the test dir (called 't').


   Q1.6: I'm interested in the bleeding edge version of the code, where can
	 I get it?

      A: Go to http://cvs.bioperl.org and you'll see instructions on how to
	 get the CVS code.

	 Basically:

	 % cvs -d :pserver:cvs@cvs.bioperl.org:/home/repository/bioperl
	 login

	 Enter 'cvs' for the password

	 % cvs -d :pserver:cvs@cvs.bioperl.org:/home/repository/bioperl co
	 bioperl_all


   Q1.7: Who uses this toolkit?

      A: Lots of people. Sanger Centre, EBI, many large and small academic
	 laboratories, large and small pharmaceutical companies. All the
	 developers on the bioperl list use the toolkit in some capacity on
	 a regular basis.

	 The Genquire annotation system
	 (http://www.bioinformatics.org/Genquire/) and Ensembl
	 (http://www.ensembl.org/) use bioperl as the basis for their
	 implementation.


   Q1.8: How should I cite Bioperl?

      A: Please cite it as:

	 
		   Stajich JE, Block D, Boulez K, Brenner SE, Chervitz SA, 
	 
		   Dagdigian C, Fuellen G, Gilbert JGR, Korf I, Lapp H, 
		   Lehvaslaiho H, Matsalla C, Mungall CJ, Osborne BI,
		   Pocock MR, Schattner P, Senger M, Stein LD, Stupka ED, 
		   Wilkinson M, Birney E.
		   The Bioperl Toolkit: Perl modules for the life sciences.
	 
		   Genome Research. 2002 Oct;12(10):1611-8.

	 If you use the Bio::PopGen modules, please cite:

	  Stajich JE and Hahn MW "Disentangling the Effects of Demography
	 and Selection in Human History." (2005) Mol Biol Evol 22(1):63-73.


   Q1.9: What are the license terms for Bioperl?

      A: Bioperl is licensed under the same terms as Perl itself which is
	 the Perl Artistic License. You can see more information on that
	 license at http://www.perl.com/pub/a/language/misc/Artistic.html
	 and http://www.opensource.org/licenses/artistic-license.html.


  Q1.10: I want to help, where do I start?

      A: Bioperl is a pretty diverse collection of modules which has grown
	 from the direct needs of the developers participating in the
	 project.  So if you don't have a need for a specific module in the
	 toolkit it becomes hard to just describe ways it needs to be
	 expanded or adapted.  One area, however is the development of
	 stand alone scripts which use bioperl components for common tasks.
	  Some starting points for script: find out what people in your
	 institution do routinely that a shortcut can be developed for. 
	 Identify modules in bioperl that need easy interfaces and write
	 that wrapper - you'll learn how to use the module inside and out.
	 We always need people to help fix bugs - check the Bugzilla bug
	 tracking system (http://www.bioperl.org/bugs).


  Q1.11: I've got an idea for a module how do I contribute it?

      A: We suggest the following.  Post your idea to the bioperl list,
	 bioperl-l@bioperl.org. If it is a really new idea consider taking
	 us through your thought process.  We'll help you tease out the
	 necessary information such as what methods you'll want and how it
	 can interact with other bioperl modules.  If it is a port of
	 something you've already worked on, give us a summary of the
	 current methods.  Make sure there is an interface to the module,
	 not just an implementation (see the biodesign.pod for more info)
	 and make sure there will be a set of tests that will be in the t/
	 directory to insure that your module is tested.


  Q1.12: Why can't I easily get a list of all the methods a object can
	 call?

      A: This a problem with perl, not only with bioperl. To list all the
	 methods, you have to walk the inheritance tree and standard perl
	 is not able to do it. As usual, help can be found in the CPAN.
	 Install the CPAN module Class::Inspector and put the following
	 script 'perlmethods' into your path and run it, e.g, >perlmethods
	 Bio::Seq.

	 
		   #!/usr/bin/perl -w
		   use Class::Inspector;
		   $class = shift || die "Usage: methods
	 perl_class_name\n";
		   eval "require $class";
		   print join ("\n", sort
	 @{Class::Inspector->methods($class,'full','public')}),
		   "\n";


  Q1.13: Can you explain the Object Model design and rationale?

      A: 
	 There is no simple answer to this question.  Simply put, this is a
	 toolkit which has grown organically.  The goals and user audience
	 has evolved.  Some decisions have been made and we have been
	 forced to live by them rather than destroy backward compatibility.
	  In addition there are different philosophies of software
	 development.  The major developers on the project have tried to
	 impose a set of standards on the code so that the project can be
	 coordinated without every commit being cleared by a few key
	 individuals (see Eric S. Raymond's "The Cathedral and the Bazaar"
	 for different styles of running an open-source project - we are
	 clearly on the Bazaar end).

	 
	 The biodesign.pod document in the bioperl distribution and
	 available on the website
	 http://bioperl.org/Core/Latest/biodesign.html talks more about
	 specific design goals.

	 
	 The clear consensus of the project developers is that Bioperl
	 should be consistent.	This may cause us to pay the price of some
	 copy-and-paste of code, with the Get/Set accessor methods being a
	 sore spot for some, and the lack of using AUTOLOAD.  By being
	 consistent we hope that someone can grok the gist of a module from
	 the basic documentation, see example code, and get a set of
	 methods from the API documentation.  We aim to make the core
	 object design easy to understand.  This has not been realized by
	 any stretch of the imagination as the toolkit has well over 1000
	 modules in bioperl-live and bioperl-run alone.

	 
	 That said we do want to improve things.  We want to experiment
	 with newer modules which make Perl more Object-Oriented.  We have
	 high hopes for some of the promises of Perl6.	To try and realize
	 this goal we are encouraging developers to play with new object
	 models in a bioperl-experimental project.  

	 
	 Some useful discussion on the mailing list can be found at this
	 node
	 http://bioperl.org/pipermail/bioperl-l/2003-December/014406.html. 
	  We encourage you to participate in the discussion and to join in
	 the development process either on existing Bioperl code or the
	 bioperl-experimental code if you have a particular interest in
	 making the toolkit more Object-Oriented.


---------------------------------------------------------------------------

2. Sequences

---------------------------------------------------------------------------



   Q2.1: How do I parse a sequence file?

      A: Use the Bio::SeqIO system.  This will create Bio::Seq objects for
	 you.  See the tutorial bptutorial.pl for more information or the
	 SeqIO HOWTO or the documentation for Bio::SeqIO (e.g. 'perldoc
	 SeqIO.pm').


   Q2.2: I can't get sequences with Bio::DB::GenBank any more, why not?

      A: NCBI changed the web CGI script that provided this access.  You
	 must be using bioperl <= 0.7.2.  The developer release 0.9.3
	 contains this fix as does the 1.0 release.


   Q2.3: How can I get NT_ or NM_ or NP_ accessions from NCBI
		 (Reference Sequences)?

      A: Use Bio::DB::RefSeq not Bio::DB::GenBank or Bio::DB::GenPept when
	 you are retrieving these accessions. This is still an area of
	 active development because the data providers have not provided
	 the best interface for us to query.  EBI has provided a mirror
	 with their dbfetch system which is accessible through the
	 Bio::DB::RefSeq object however, there are cases where NT_
	 accessions will not be retrievable.


   Q2.4: How can I use SeqIO to parse sequence data to or from a string?

      A: From a string:

	 
		   use IO::String;
		   use Bio::SeqIO;
		   my $stringfh = new IO::String($string);
		   
		   my $seqio = new Bio::SeqIO(-fh => $stringfh, 
					      -format => 'fasta');
		   while( my $seq = $seqio->next_seq ) { 
		     # process each seq
		   }

	 And here is how to write to a string:

	 
		   use IO::String;
		   use Bio::SeqIO;
		   my $s;
		   my $io = IO::String->new(\$s);
		   my $seqOut = new Bio::SeqIO(-format =>'swiss', -fh =>
	 $io);
		   $seqOut->write_seq($seq1);
		   print $s; # $s contains the record


   Q2.5: I'm using Bio::Index::Fasta in order to retrieve sequences from my
	 indexed fasta file but I keep seeing ">> MSG: Did not provide a
	 valid Bio::PrimarySeqI object" when I call fetch() followed by
	 SeqIO::write_seq(). Why?

      A: It's likely that fetch() didn't retrieve a Bio::Seq object. There
	 are few possible explanations but the most common cause is that
	 the id you're passing to fetch() is not the key to that sequence
	 in the index. For example, if the fasta header is ">gi|12366" and
	 your id is "12366" fetch() won't find the sequence, it expects to
	 see "gi|12366". You need to use the get_id() method to specify the
	 key, like this:

	 
		   $inx = Bio::Index::Fasta->new(-filename =>$indexname);
		   $inx = id_parser(\&get_id);
		   $inx->make_index($fastaname);
		   
		   sub get_id {
		   my $header = shift;
		   $header =~ /^>gi\|(\d+)/;
		   $1;
		   }

	 
		 The same issue arises when you use Bio::DB::Fasta, but in
	 that case the code might look like this:

	 
		   $inx = Bio::DB::Fasta->new($fastaname,-makeid
	 =>\&get_id);


   Q2.6: I'm using Bio::DB::GenBank to query Genbank and I'm certain that
	 the id is there but I'm seeing the error "MSG: acc does not
	 exist".

      A: This bug in versions 1.2 and 1.2.1, but it is fixed in 1.2.2.
	 Either upgrade to 1.2.2 or edit Bio/DB/GenBank.pm and change
	 'protein' to 'nucleotide' in the BEGIN block.


---------------------------------------------------------------------------

3. Report parsing

---------------------------------------------------------------------------



   Q3.1: I want to parse BLAST, how do I do this?

      A: Bioperl only supports one approach, Bio::SearchIO, as of version
	 1.1. There are other Blast parsing modules in the package but they
	 remain just to support older code.

	 SearchIO supports BLAST, PSIBLAST, HMMER, WABA, BLASTZ (AXT),
	 exonerate, Megablast, PSL, SIM4, WISE, and fasta report parsing. 
	 The bptutorial provides an example of how to use this system as
	 well as the documentation in the Bio::SearchIO system. There is
	 also a SearchIO HOWTO.


   Q3.2: What was wrong with Bio::Tools::Blast?

      A: Bio::Tools::Blast* is no longer supported, as of Bioperl version
	 1.1. Nothing is really wrong with it, it has just been outgrown by
	 a more generic approach to reports.  This generic approach allows
	 us to just write pluggable modules for fasta and Blast parsing
	 while using the same framework.  This is completely analogous to
	 the Bio::SeqIO system of parsing sequence files.  However, the
	 objects produced are of the Bio::Search rather than Bio::Seq
	 variety.


   Q3.3: I want to parse FastA or NCBI -m7 (XML) format, how do I do this?

      A: It is as simple as parsing text BLAST results - you simply need to
	 specify the format as "fasta" or "blastxml" and the parser will
	 load the appropriate module for you.  You can use the exact logic
	 and code for all of these formats as we have generalized the
	 modules for sequence database searching.


   Q3.4: Let's say I want to do pairwise alignments of 2 sequences. How can
	 I do this?

      A: Look at Bio::Factory::EMBOSS to see how to use the 'water' and
	 'needle' alignment programs that are part of the EMBOSS suite.
	 Bio::Factory::EMBOSS is part of the bioperl-run package.

	 Or you can use the pSW module for DNA alignments or the dpAlign
	 module for protein alignments. These are part of the bioperl-ext
	 package (distributed separated at ftp://bioperl.org/pub/DIST).


   Q3.5: I'm using Bio::Search* and its frame() to parse Blast but I'm
	 seeing 0, 1, or 2 instead of the expected -3, -2, -1, +1, +2, +3.
	 Why am I seeing these different numbers and how do I get the frame
	 according to Blast?

      A: These are GFF frames - so +1 is 0 in GFF, -3 will be encoded with
	 a frame of 2 with the strand being set to -1 (for more on GFF see
	 http://www.sanger.ac.uk/Software/formats/GFF/GFF_Spec.shtml).

	 Frames are relative to the hit or query sequence so you need to
	 query it based on sequence you are interested in:

	 $hsp->hit->strand();
		   $hsp->hit->frame();

	 or

	 $hsp->query->strand();
		   $hsp->query->frame();

	 So the value according to a blast report of -3 can be constructed
	 as:

	 my $blastvalue = ($hsp->query->frame + 1) * $hsp->query->strand;


   Q3.6: How do I tell BLAST to search multiple database using
	 Bio::Tools::Run::StandAloneBlast?

      A: Put the names of the databases in a variable. like so:

	 
		   my $dbs = '"/dba/BMC.fsa /dba/ALC.fsa /dba/HCC.fsa"';
		   my @params = ( d	      => "$dbs",
		   program     => "BLASTN",
		   _READMETHOD => "Blast",
		   outfile     => "$dir/est.bls" );
		   
		   my $factory =
	 Bio::Tools::Run::StandAloneBlast->new(@params);
		   my $seqio = Bio::SeqIO->new(-file=>'t/amino.fa',-format
	 => 'Fasta' );
		   my $seqobj = $seqio->next_seq();
		   $factory->blastall($seqobj);


   Q3.7: Can I get domain number from hmmpfam or hmmsearch output? E.g.
		   SH2_5: domain 2 of 2, from 349 to 432: score 104.4, E =
	 1.9e-26

      A: Not directly but you can compute it since the domains are numbered
	 by their order on the protein:

	 
		     my @domains = $hit->domains;
		     my $domainnum = 1;
		     my $total = scalar @domains;
		     foreach my $domain ( sort { $a->start <=> $b->start }
	 $hit->domains ) {
		       print "domain $domainnum of $total,\n";
		       $domainnum++;
		     }


   Q3.8: Does SearchIO parse the HTML output that BLAST creates?

      A: 
	 Yes, with a twist. You can modify SearchIO's _readline() method
	 such that it reads in the HTML and strips it of tags using the
	 HTML::Strip module:

	 
	 use Bio::SearchIO;
	 use HTML::Strip;
	 
	 my $hs = HTML::Strip->new();
	 
	 # replace the blast parser's _readline method with one that
	 # auto-strips HTML:
	 package Bio::SearchIO::blast; 
	 
	 sub Bio::SearchIO::blast::_readline {
	     my ($self, @args) = @_;
	     my $line = $self->SUPER::_readline(@args);
	     return unless defined $line;
	     return $hs->parse($line);
	 }
	 
	 my $in = new Bio::SearchIO(-format => 'blast',
				    -file   => $file);


---------------------------------------------------------------------------

4. Utilities

---------------------------------------------------------------------------



   Q4.1: How do I find all the ORFs in a nucleotide sequence? Antigenic
	 sites in a protein? Calculate nucleotide melting temperature? Find
	 repeats?

      A: In fact, none of these functions are built into Bioperl but they
	 are all available in the EMBOSS package (http://www.emboss.org/),
	 as well as many others. The Bioperl developers created a simple
	 interface to EMBOSS such that any and all EMBOSS programs can be
	 run from within Bioperl. See Bio::Factory::EMBOSS for more
	 information, it's in the bioperl-run package.

	 If you can't find the functionality you want in Bioperl then make
	 sure to look for it in EMBOSS, these packages integrate quite
	 gracefully with Bioperl. Of course, you will have to install
	 EMBOSS to get this access.

	 In addition, Bioperl after version 1.0.1 contains the Pise/Bioperl
	 modules. The Pise package
	 (http://www-alt.pasteur.fr/~letondal/Pise) was designed to provide
	 a uniform interface to bioinformatics applications, and currently
	 provides wrappers to greater than 250 such applications! Included
	 amongst these wrapped apps are HMMER, Phylip, BLAST, GENSCAN, even
	 the EMBOSS suite. Use of the Pise/Bioperl modules does not require
	 installation of the Pise package.


   Q4.2: How do I do motif searches with Bioperl? Can I do "find all
	 sequences that are 75% identical" to a given motif?

      A: There are a number of approaches. Within Bioperl take a look at
	 Bio::Tools::SeqPattern. Or, take a look at the TFBS package, at
	 http://forkhead.cgb.ki.se/TFBS (Transcription Factor Binding
	 Site). This Bioperl-compliant package specializes in pattern
	 searching of nucleotide sequence using matrices.

	 It's also conceivable that the combination of Bioperl and Perl's
	 regular expressions could do the trick. You might also consider
	 the CPAN module String::Approx (this module addresses the percent
	 match query), but experienced users question whether its distance
	 estimates are correct, the Unix agrep command is thought to be
	 faster and more accurate.  Finally, you could use EMBOSS, as
	 discussed in the previous question (or you could use Pise to run
	 EMBOSS applications). The relevant programs would be fuzzpro or
	 fuzznuc.


   Q4.3: Can I query MEDLINE or other bibliographic repositories using
	 Bioperl?

      A: Yes! The solution lies in Bio::Biblio*, a set of modules that
	 provide access to MEDLINE and OpenBQS-compliant servers using
	 SOAP. See Bio/Biblio.pm, scripts/biblio.PLS, or examples/biblio/*
	 for details and example code.


---------------------------------------------------------------------------

5. Annotations and Features

---------------------------------------------------------------------------



   Q5.1: I get the warning "(old style Annotation) on new style
	 Annotation::Collection".  What is wrong?

      A: This is because we have transitioned from the
	 add_Comment/each_Comment, add_Reference/each_Reference style to
	 add_Annotation('comment', $ann)/get_Annotations('comment). Please
	 update your code in order to avoid seeing these warning messages.

	 The objects have also changed from the Bio::Annotation object to
	 the Bio::Annotation::Collection object, starting with v. 1.0. This
	 is a more general and extensible system.  In the future the
	 Reference objects will likely be implemented by the Bio::Biblio
	 system but we hope to maintain a compatible API for these. 


   Q5.2: How do I retrieve all the features from a Sequence?  How about all
	 the features which are exons or have a /note field that contains a
	 certain gene name?

      A: To get all the features:

	 my @features = $seq->all_SeqFeatures();

	 To get all the features filtering on only those which have the
	 primary tag 'exon'.

	 my @genes = grep { $_->primary_tag eq 'exon'} 
		   $seq->all_SeqFeatures();

	 To get all the features filtering on this which have the tag
	 'note' and within the note field contain the requested string
	 $noteval.

	 
		   my @f_with_note = grep { 
		   my @a = $_->has_tag('note') ?
		   $_->each_tag_value('note') : (); 
		   grep { /$noteval/ } @a; 
		   }  $seq->all_SeqFeatures(); 


   Q5.3: How do I parse the CDS join() or complement() statements in
	 Genbank or EMBL files to get the sub-locations, like the
	 coordinates "45" and "122" in "join(45..122,233..267)"?

      A: You could use primary_tag() to find the CDS features and the
	 Location::SplitLocationI object to get the coordinates:

	 
		   foreach my $feature ($seqobj->top_SeqFeatures){
		     if (
	 $feature->location->isa('Bio::Location::SplitLocationI') 
		   && $feature->primary_tag eq 'CDS' )	{
		       foreach my $location (
	 $feature->location->sub_Location ) {
			 print $location->start . ".." . $location->end .
	 "\n";
		       }
		     }
		   }  


   Q5.4: How do I retrieve a nucleotide coding sequence when I have a
	 protein gi number?

      A: You could go through the protein's feature table and find the
	 'coded_by' value. The trick is to associate the coded_by
	 nucleotide coordinates to the nucleotide entry, which you'll
	 retrieve using the accession number from the same feature.

	 
		   my $gp = new Bio::DB::GenPept;
		   my $gb = new Bio::DB::GenBank;
		   # factory to turn strings into Bio::Location objects
		   my $loc_factory = new Bio::Factory::FTLocationFactory;
		   
		   my $prot_obj = $gp->get_Seq_by_id($protein_gi);
		   foreach my $feat ( $prot_obj->top_SeqFeatures ) {
		     if ( $feat->primary_tag eq 'CDS' ) {
		     # example: 'coded_by="U05729.1:1..122"'
		       my @coded_by = $feat->each_tag_value('coded_by');
		       my ($nuc_acc,$loc_str) = split /\:/, $coded_by[0];
		       my $nuc_obj = $gb->get_Seq_by_acc($nuc_acc);
		     # create Bio::Location object from a string
		       my $loc_object =
	 $loc_factory->from_string($loc_str);
		     # create a Feature object by using a Location
		       my $feat_obj = new
	 Bio::SeqFeature::Generic(-location =>$loc_object);
		     # associate the Feature object with the nucleotide Seq
	 object
		     $nuc_obj->add_SeqFeature($feat_obj);
		     my $cds_obj = $feat_obj->spliced_seq;
		     print "CDS sequence is ",$cds_obj->seq,"\n";
		     }
		   }


   Q5.5: How do I get the complete spliced nucleotide sequence from the CDS
	 section?

      A: You can use the spliced_seq() method. For example:

	 
		   my $seq_obj = $db->get_Seq_by_id($gi);
		   foreach my $feat ( $seq_obj->top_SeqFeatures ) {
		     if ( $feat->primary_tag eq 'CDS' ) {
		       my $cds_obj = $feat->spliced_seq;
		       print "CDS sequence is ",$cds_obj->seq,"\n";
		     }
		   }


   Q5.6: How do I get the reverse-complement of a sequence using the
	 subseq() method?

      A: One way is to pass the location to subseq() in the form of a
	 Bio::Location object. This object holds strand information as well
	 as coordinates.

	 
		   use Bio::Location::Simple;
		   
		   my $location = new Bio::Location::Simple(-start  =>
	 $start,
							    -end    =>
	 $end,
							    -strand => "-"
	 );
		   # assume we already have a sequence object
		   my $rev_comp_substr = $seq_obj->subseq($location);


---------------------------------------------------------------------------

6. Running external programs

---------------------------------------------------------------------------



   Q6.1: How do I run Blast from within Bioperl?

      A:  Use the module Bio::Tools::Run::StandAloneBlast.  It will give
	 you access to many of the search tools in the NCBI blast suite
	 including blastall, bl2seq, blastpgp.	The basic structure is like
	 this.
		 
		 use Bio::Tools::Run::StandAloneBlast;
		   my $factory = Bio::Tools::Run::StandAloneBlast->new(p =>
	 'blastn',
								       d =>
	 'nt',
								       e =>
	 '1e-5');
		   my $seq = new Bio::PrimarySeq(-id => 'test1',
						 -seq =>
	 'AGATCAGTAGATGATAGGGGTAGA');
		   my $report = $factory->blastall($seq);


   Q6.2: Hey, I want to run clustalw within Bioperl, I used
	 Bio::Tools::Run::Alignment::Clustalw before - where did it go?

      A: The Bio::Tools::Run directory was moved to a new package,
	 bioperl-run, to help make the size of the core code smaller and
	 separate out the more specialized nature of application running
	 from the rest of Bioperl.  You can get these modules by installing
	 the bioperl-run package.  This is either available from CVS under
	 the same name or available in the http://bioperl.org/DIST
	 directory and on CPAN.  This changeover began in the bioperl 1.1
	 developer release.


   Q6.3: What does the future hold for running applications within Bioperl?

      A: We are trying to build a standard starting point for analysis
	 application which will probably look like
	 Bio::Tools::Run::AnalysisFactory which will allow the user to
	 request which type of remote or local server they want to use to
	 run their analyses.  This will connect to the Pasteur's PISE
	 server, the EBI's Novella server, as well as be aware of wrappers
	 to run applications locally.

	 Additionally we suggest investigating the BioPipe project, also
	 known as bioperl-pipeline, at www.biopipe.org. This is a
	 sophisticated system to chain together sets of analyses and build
	 rules for performing these computes.


   Q6.4: I'm trying to run StandAloneBlast and I'm seeing error messages
	 like "Can't locate Bio/Tools/Run/WrapperBase.pm". How do I fix
	 this?

      A: Yes, this file is missing in version 1.2. Two possible solutions:
	 install version 1.2.1 or greater or retrieve and copy
	 WrapperBase.pm to the proper location. You can get it at
	 http://bio.perl.org/Bugs.


---------------------------------------------------------------------------

7. Other Bioperl packages

---------------------------------------------------------------------------



   Q7.1: What is bioperl-ext?

      A:  bioperl-ext is a package of code for C-extensions (hence the
	 'ext') to Bioperl.  These include interfacing to the staden IO
	 library (the io_lib library) for reading in chromatogram files and
	 Bio::Ext::Align which is a smith waterman implementation.


   Q7.2: I can't seem to get bioperl-ext to compile the staden IO lib part,
	 what do I do?

      A: Make sure you read the README about copying files over. Some more
	 items to check off before asking.

	 1. Are you *sure* io_lib is installed where you think it is, and
	 that the install path is seen by Perl (did you answer the
	 questions during perl Makefile.PL?)

	 2. Did you copy the various missing .h files (os.h config.h if I
	 remember right) from your io_lib source directory into the install
	 include directory when installing io_lib?

	 3. When you ran make for io_lib did you see any errors or messages
	 about how you should probably run "ranlib" on the library object?

	 4. Did you run "ranlib" on the installed libread file(s)?

---------------------------------------------------------------------------
Copyright (c)2002-2004 Open Bioinformatics Foundation. You may distribute
this FAQ under the same terms as perl itself.

